Example sentences of "shown to be [verb] [prep] " in BNC.
Next pageNo | Sentence |
---|---|
1 | However , the extent of this new-found tolerance is shown to be limited by the hysteria generated by the disease AIDS against male homosexuals . |
2 | The choices , assessments and selections which go into formulating a strategy , and the ingenuity or crassness displayed in implementing it , must themselves be shown to be determined by factors other than intentions . |
3 | In rodents it is difficult to identify an area that corresponds to temporal visual cortex , there is debate about the existence of a parietal visual area , and the prestriate cortex has yet to be shown to be subdivided on the basis of submodality as in primates . |
4 | The impressive free-standing sculptures on the podium of the building were shown to be made of two types of Pentelic marble . |
5 | At present , free VPDPR has not yet been shown to be absorbed into the circulation nor specific receptors in the central nervous system identified . |
6 | The proposed development is contrary to the stated policy of the local planning authority where new dwellings in the countryside are normally resisted unless they can be shown to be justified by agricultural need . |
7 | He looked at the crime figures reported by the Merseyside police , where the increase in clear-up rates could be shown to be related to the number of prison visits by police officers . |
8 | We have already seen that depressive or manic responses may be shown to be related to the problem of the son 's relation to the mother and his contradictory desire to be devoted to her as the ideal mother of hunter-gatherer prehistory and yet to be free of her as the phallic , dominant mother of primal agriculture . |
9 | However , this long term toxicity of alkylating agents has been shown to be related to the intensity of therapy given and is very unlikely to occur with the low dose needed to treat our patients . |
10 | He lists ten factors which he believes research has shown to be related to the incidence of depression : life events ; social support ; developmental object loss ; coping skills ; monoamine depletion ; monoamine oxidase level ; borderline hypothyroid function ; impact of puerperium ; alcoholism ; and familial and genetic factors . |
11 | As PLA2 has been shown to be increased in Crohn 's disease patients , it has been postulated that steroids inhibits colonic platelet activating factor synthesis by interfering with PLA 2 activity . |
12 | Mycobacterial rRNA has been shown to be raised in sarcoid spleens . |
13 | Murine NF-L , NF-M and NF-H genes as well as the chicken NF-M gene have recently been shown to be expressed after transfection in non-neuronal cells ( 38,26,39 ) . |
14 | β-Thromboglobulin levels have been shown to be elevated in various types of vascular disease . |
15 | Supporting evidence was obtained from experiments in which the ability of a depolarizing stimulus to release radiolabelled glutamate was shown to be elevated in potentiated hippocampal tissue . |
16 | The repetitive sequence ( AGGGCCCTAGAGGGGCCCTAG ) n was previously shown to be curved by gel mobility assays . |
17 | Previously it was shown that the SM1 and SM2 MHC isoforms were produced by alternative splicing of a single gene ( 6 ) but both isoforms were shown to be co-expressed in all smooth muscle cell types ( 4,5,6 ) . |
18 | In that same summer , however , occurred the incident involving the Hurufis , to be described shortly , in which Fahreddin Acemi is clearly shown to be acting as Mufti ; and he must therefore have been Mufti at the time of Molla Arab 's putative association with him . |
19 | The dilemmas of decision making for families and social workers are then related to the legal routes into care , some of which are shown to be misused in practice . |
20 | In addition a recently identified group of pain afferents ( usually functionally dormant and called ‘ sleeping nociceptors ’ ) has been shown to be activated by inflammation and may contribute to peripheral sensitisation to pain after injury . |
21 | Now , it turns out , they could n't be : in both Italy and Japan , the guardians of democracy have been shown to be enmeshed in corruption . |
22 | If it is possible to generalize from this at all , it is that presence of predator remains in a fossil assemblage gives no indication of method of origin of the assemblage , even if it can be shown to be accumulated by a predator . |
23 | The difficulty with any kind of platonism that claims the ontological primacy of qualities — or any kind of universals — is that in presenting its case it implicitly relies on certain assumptions about existentially unique particulars , which no sooner are made explicit than the whole platonist case is shown to be built on sand . |
24 | Excess salt has been shown to be linked to high blood pressure and may also affect the efficient function of the kidneys . |
25 | This pattern of impaired fetal growth has now been shown to be linked to cardiovascular disease . |
26 | Our study lends credence to the recent report of a family with many affected family members with only two to 40 colonic polyps , who were shown to be linked to the APC locus and are therefore likely to be carrying a mutation of this gene . |
27 | Heparan sulphate proteoglycan , laminin , and collagen have all been shown to be linked across cell membranes to cytoskeletal elements , and cytoskeletal proteins have been demonstrated to be condensed at cell-cell and cell-matrix interfaces . |
28 | And feeding back through that inversion is an equally scandalous interrogation of the dominant order being mimicked ; civil society is shown to be rooted in a like corruption . |
29 | In an extraordinary speech masculinity is further shown to be rooted in a sexual violence performed inseparably against both men and women — ( Vitelli to Clara ) : |
30 | For example , in many tissues , 2 2 Na can be shown to be concentrated into plasma membrane vesicles in the presence of an in to out transmembrane H + gradient . |