Example sentences of "in a previous [noun] we " in BNC.
Next pageNo | Sentence |
---|---|
1 | In a previous issue we featured global warming . |
2 | In a previous study we have shown that asymptomatic drug users positive for HIV have a nearly fourfold increased risk of acquiring bacterial pneumonia compared with drug users negative for HIV . |
3 | In a previous study we described overexpression of the p53 protein in 42% of 52 colorectal carcinomas , with the immunohistochemical detection of p53 as a marker of gene mutation . |
4 | In a previous study we found a constant phospholipid composition in different parts of the stomach ( fundus , corpus , and antrum ) . |
5 | In a previous paper we estimated that the sex and age standardised population relative risk for ulcerative colitis and Crohn 's disease was about 10 among first degree relatives of probands with ulcerative colitis and Crohn 's disease . |
6 | In a previous paper we reported that the repeating sequence 5'AGGGCCCTAGAGGGGCCCTAG3' displays an anomalous gel mobility , characteristic for curved DNA , even in the absence of AnTm tracts ( 4 ) . |