Example sentences of "in a previous [noun] [pers pn] " in BNC.
Next pageNo | Sentence |
---|---|
1 | And suppose that in a previous existence you had suffered a particularly unfortunate fate — let us say that you met your death in a burning building . |
2 | In a previous issue we featured global warming . |
3 | Yes , I can now reveal that in a previous life I was the iceberg that sunk the Titanic . |
4 | In a previous study we have shown that asymptomatic drug users positive for HIV have a nearly fourfold increased risk of acquiring bacterial pneumonia compared with drug users negative for HIV . |
5 | In a previous study we described overexpression of the p53 protein in 42% of 52 colorectal carcinomas , with the immunohistochemical detection of p53 as a marker of gene mutation . |
6 | In a previous study we found a constant phospholipid composition in different parts of the stomach ( fundus , corpus , and antrum ) . |
7 | In a previous paper we estimated that the sex and age standardised population relative risk for ulcerative colitis and Crohn 's disease was about 10 among first degree relatives of probands with ulcerative colitis and Crohn 's disease . |
8 | In a previous paper we reported that the repeating sequence 5'AGGGCCCTAGAGGGGCCCTAG3' displays an anomalous gel mobility , characteristic for curved DNA , even in the absence of AnTm tracts ( 4 ) . |
9 | Sampson joins IXI from Cray Europe , though in a previous incarnation he was one of Scott McNealy 's original recruits when Sun Microsystems Inc set up its European hub back in 1984 . |
10 | In a previous book I suggested that it might be parasitic , freeloading on the efforts of the 1 per cent , a theory that has more recently been taken up by molecular biologists under the name of ‘ selfish DNA ’ . |