Example sentences of "not in the [noun prp] " in BNC.
Next pageNo | Sentence |
---|---|
1 | A number of consonant blends — including /nk/ ( ‘ monkey ’ ) /nz/ ( ‘ wings ’ ) and/ns/ ( pencil' ) — appear in the EAT , but not in the Goldman-Fristoe . |
2 | bet that 's not in the Oxford Dictionary . |
3 | However , Livings was not in the USA to see Dustin and a cast which included Dana Elcar , Elizabeth Wilson ( who would play Dustin 's mother in The Graduate ) and Carl Gabler when it opened at Circle-In-The-Square at Bleeker Street on 16 October 1966 . |
4 | But the immediate cause of the growth of unemployment in western Europe to a peak of 19 million in 1986 was a sharp deterioration since 1979 ( Table 2.4 ) in Europe , but not in the USA . |
5 | The sporty 1.5-litre twin-cam coupe , known on the home market as the Cynos , is gunning straight for the Honda CRX and Nissan NX coupe — but not in the UK , because exports to this country are n't planned . |
6 | It is fitted in West Germany and the USA but not in the UK . |
7 | Dairy cows ( up to 10 per farm ) , calves and bulls are eligible for compensatory payments in France but not in the UK . |
8 | The major difference is that a limit on HLCAs per farm exists in the French LFA ( either 30 or 40 LUs per farm depending on LFA zone ) but not in the UK , encouraging farm expansion , capital developments and overstocking in the UK uplands . |
9 | If this is the case , you may be taxed on the income in your new residence — and not in the UK . |
10 | And it reckons there is very little standing in its way — according to Parker , its four major competitors have nothing to rival the new product — Dun & Bradstreet Software Corp has incompatible products ; SAP AG is strong in Germany and other continental countries but not in the UK ; Walker Interactive Systems Inc offers purely mainframe software ; and Computer Associates International Inc has a poor reputation for financial packages . |
11 | Although donors may be asked to donate for a patient not in the UK the bone marrow is still taken as stated before and the collected marrow sent to the patient . |
12 | Homophonic real words ( e.g. rain , reign ) , however , take longer to be responded to than non-homophonic ( real ) words in the RVF but not in the LVF ( Barry , 1981 ) . |
13 | The effect of imposing taxes unilaterally rather than globally ( for example , within the EC but not in the US or Japan ) , would mean that countries less stringent in their environmental policies may become more attractive as locations for production . |
14 | Ernie teaches Mike the tricks of his nefarious trade , mostly by a process known ( if not in the US ) as ‘ sitting next to Nellie ’ , or on-the-job training . |
15 | But not in the Lake District — the last bastion . |
16 | The declarations for both races were made yesterday but , when the final list was released , three horses — Loki , Pay Homage and Cool Luke — were not in the Lincoln line-up . |
17 | Firewatching was compulsory for everyone between 16 and 18 years and for those over 50 who were not in the HG , or ARP . |
18 | In [ 17 ] the author writes that he had been saying that Gardner looked very square : But of course Carver had not actually said that Gardner looked very square , at least not in the Gricean ( Grice 1981 ) sense of the word . |
19 | For all their bluster about foreign conspiracy , the foreigners who worry them most live not in the United States or Western Europe but in Hungary , Poland and the Soviet Union . |
20 | He did not disclose the substance of the Libyan suggestions but a delegate at the meeting told Reuters : ‘ Libya 's proposals are still along the lines of its known positions , that the two could be tried only in a third country and not in the United States or Britain . ’ |
21 | But anyway , there are too many bucks in this warren , and it 's pretty poor fun for any rabbit that 's not in the Owsla . |
22 | At last he recalled it was not in the Nightingale Gallery but in the one running to the left . |
23 | Declan Bonner was not in the Donegal line-up — he was far too busy running the show in a club championship match . |
24 | Irrespective of this , we have seen a character wearing a white volupeer earlier in the text : not in the Reeve 's Tale , but Alison , in the Miller 's Tale ( 3241 ) . |
25 | The round hollow hammers , typical of the pianos of both Cristofori and Silbermann , are found in other pianos by Stein but not in the Verona piano . |
26 | Not in the Andes . |
27 | Moreover , the thin string-playing and low-level recording are not in the Concertgebouw/Decca class . |
28 | Needless to say , there was no promise of 90% grant-aid which was not in the Ashby Report anyway , but the Minister did agree to reconsider the proposal to omit Tutorial Classes from the grant regulations . |
29 | Keegan offered him improved terms this week but , why he is not in the Newcastle first team remains a mystery . |
30 | Considering the published data of AG/CT , TA , GG/CC and GC wedge-roll values ( 1,6 ) , the preferential curvature of PyPu ( TA ) , compared to PuPy ( GC ) steps ( 12 ) and crystallographic data ( 10,11 ) , we expected that the region with the major groove-directed curvature is located in the CTAGAG , and not in the GGGCCC part of the curved ( AGGGCCCTAGAGGGGCCCTAG ) n DNA ( 4 ) . |