Example sentences of "is [adv] [adv] [to-vb] " in BNC.
Next page| No | Sentence |
|---|---|
| 1 | The intent is rather merely to summarize the account of his life as given by Taskopruzade and Mecdi in order to convey the general course of his career . |
| 2 | The food 's quality is not improved by the fact that the watch is rarely there to eat on time . |
| 3 | One bad year is rarely enough to produce famine . |
| 4 | He is right also to say that the value is not just for Yarrow . |
| 5 | It is right now to insist that nothing in the Anglo-French study shows AZT to be ineffective in the late treatment of AIDS ; it is to be hoped that point will be tested by a new controlled study . |
| 6 | The reason why I take such a strong line on the set-aside scheme is not merely that it is right so to do . |
| 7 | Part of the task of the modern tobacco promoter is to make the smoking habit appear clean and healthy , and to imply that it is all right to smoke if we take plenty of exercise . |
| 8 | The Treasury Select Committee will have fun discussing the precise significance of that measure , which is another attempt to talk up the economy and persuade consumers that it is all right to spend now . |
| 9 | ‘ I suppose it is all right to talk ? ’ |
| 10 | It is all right to tell a whopper on an answering machine ( ‘ We 're sorry that we can not answer your call right now ’ is either a lie or a statement of the obvious ) , but no one will forgive you for not ‘ getting back ’ to him later . |
| 11 | Caller : Well , I just wanted to ask the manager if it is all right to bring my poodle with me ? |
| 12 | They are going to give the children the idea that it is all right to change the facts to suit your way of thinking . |
| 13 | We must face the problem of possible rejection and realize it is all right to show our true feelings and that it is all right to be rejected . |
| 14 | Facing the realities of the background that has moulded their early life and finding forgiveness and understanding for those who , in the name of love , have moulded this type into submission , and learning that it is all right to show feeling and emotions will ultimately bring release and freedom to follow as their hearts dictate . |
| 15 | Perhaps the Minister could clarify the impression given by the Hon. Member for Tayside , North ( Mr. Walker ) , who believes that it is all right to buy from the public purse something for £2 million and then to sell off a fraction of it for £4 1 million a fortnight later as long as the proceeds of the sale go to buses . |
| 16 | Stay in your chair until you are told it is all right to get up — the camera may still be on you . |
| 17 | To succeed in thinking instead of the content , it seems , is necessarily also to think of something else , to think of that which exists for something else . |
| 18 | I myself put my faith in diazepam I 've got gram diazepam which is very slight , very small dose and is enough just to stop you caring so much about whatever it is that 's really bugging you . |
| 19 | ‘ Women suffer from it more than men — especially women who have been brought up to think that it is enough just to look beautiful . ’ |
| 20 | These points are not laboured but there is enough here to suggest a few topics to which the inexperienced paddler should devote further thought and reading . |
| 21 | It is enough here to note the span of its coverage and the scale of the undertaking . |
| 22 | In Scotland , actual distribution or display must be shown to have occurred , whereas in England and Wales it is enough merely to establish ‘ intent ’ . |
| 23 | The number of trekkers going into the area is only partially to blame . |
| 24 | These are waters which do not , as a rule , produce big bream , for with so many mouths to share the available food there is only enough to maintain them at a low body weight . |
| 25 | We are readily persuaded to postpone any criticisms we may have of his mode of telling the story , and the next two lines make it clear that the tale is only there to bring out a moral . |
| 26 | And he thinks the gloss that surrounds some 4AD groups is only there to mask the lack of real songs . |
| 27 | I congratulate you that there is so soon to appear another volume of your favourite Mrs. Leapor 's poetry . |
| 28 | I think it is perhaps also to do with my love of remote places , my love of mountains rather than cities . |
| 29 | Epictetus replied , ‘ To all this it is perhaps enough to answer , I do not need them . ’ |
| 30 | The effect of the GC step in the context of GGGCCC motif seems to be about as large as that of AA/TT , i.e. it is apparently enough to cancel the macroscopic curvature of helically phased A-tracts.The origin of the macroscopic curvature for the ( AGGGCCCTAGAGGGGCCCTAG ) n DNA can be explained by an overall roll angle difference between the GGGCCC and CTAGAG sequence elements , which will add up if the two motifs are separated by a distance close to the helical repeat length . |