Example sentences of "its [adj] at the " in BNC.
Next pageNo | Sentence |
---|---|
1 | Equilibrium is at its lowest at the water 's surface and as pressure is exerted on the bladder its volume decreases which causes the fish to ‘ sink ’ . |
2 | Recombinants ‘ oligo I ’ and ‘ oligo III ’ were produced by cloning the sequence CTGGGGAGGCGACCCCTCCCCCCTTGTCCCGACT ( nts -527 to -494 ) and its complementary or the oligonucleotide TCGCCCAGCTCAGGGCCGCGTGTGTTAGTT ( nts -479 to -450 ) and its complementary at the HindIII site of plasmid pBLcat2 ( 16 ) . |
3 | The great problem for any navigator was to know where his ship was : it was relatively easy to determine the latitude , which measures distance north or south of the equator , but it was much harder to find the longitude , or distance east or west of a fixed meridian — a line from pole to pole running through all the points at which the sun is at its highest at the same moment . |
4 | Yet for Labour to win on its own at the next general election would be a victory on a scale comparable with that achieved by Attlee in 1945 . |
5 | Its Studio Theatre has a life of its own at the forefront of creative theatre . |
6 | At first sight , this seems to be an attractive move : holding hearings behind closed doors has led to accusations that the Institute is protecting its own at the expense of the public interest . |
7 | line of type on its own at the top or bottom of a page . |