Example sentences of "[pers pn] expect [conj] the [noun] " in BNC.
Next pageNo | Sentence |
---|---|
1 | I expect that the Minister can reassure him that an environmental impact assessment can not have been made properly for that incinerator yet , because an application does not yet appear to have been made . |
2 | And I expect that the King would be interpreting the general feeling of the people of the country that , true to British ideas , the Government , whoever they may be , should have a fair chance … ’ |
3 | I expect that the paddock in particular contributes to the character of Skelton , and inclusion in the conservation area . |
4 | I expect that the people who made them were influenced by the Labour party 's ’ Standard No. 17 ’ , which was circulated among people in the area . |
5 | Always ready to look on the bright side she expected that the remission would last for a long time , and there was a conspiracy between Maureen and her mother to conceal Julia 's suffering from her . |
6 | Considering the published data of AG/CT , TA , GG/CC and GC wedge-roll values ( 1,6 ) , the preferential curvature of PyPu ( TA ) , compared to PuPy ( GC ) steps ( 12 ) and crystallographic data ( 10,11 ) , we expected that the region with the major groove-directed curvature is located in the CTAGAG , and not in the GGGCCC part of the curved ( AGGGCCCTAGAGGGGCCCTAG ) n DNA ( 4 ) . |
7 | When we are hurt by someone 's behaviour , all that is happening is that we are disappointed because they do not behave in the way we expect and the reality conflicts with our ideals . |
8 | May we expect that the cost of transporting freight from the mainland to Orkney and Shetland will be comparable with the cost of such transport to the Western Isles ? |
9 | So that 's all got to happen and can we expect that the improvements that have been made now to the syst to the management of this process will not give rise to the same delays that occurred in getting this system flight safe . |
10 | Any moment now they expected that the Collector would make up his mind to do something about it . |
11 | Derek Hegarty says it 's been tougher than they expected because the winds up in Scotland were very strong and after a few days they had troubles with their knees but they 've managed to keep going … |
12 | Thomas McNamara , the US ambassador to Colombia , stated that Colombia 's drug policy was also on trial , but he expected that the USA would co-operate with the Colombian authorities by handing over evidence against Escobar [ see p. 38001 ] . |
13 | The Head of Department said he expected that the review would ‘ follow them through the normal day ’ , looking at ‘ the way we run the department ; the way we work according to the syllabus — how we relate to it ; the stock control ; the use of resources ; the teaching content and the skills taught ’ ( verified note of meeting ) . |
14 | He expected that the report would not be fully comparative for at least another two years . |