Example sentences of "[noun sg] close to the [adj] " in BNC.
Next pageNo | Sentence |
---|---|
1 | McLaren boss Teddy Mayer as much as admitted at the end of 1975 that he thought Emerson wanted to move — or that he was in personal trouble of one kind and another — but the official news reached Hunt before it got to the team , and got to Hunt through Domingos Piedade , an eccentric figure close to the cheerful groupie Googie Zanon , a wealthy ( textiles ) Italian aristocrat whose support has been crucial to many drivers at critical points in their career , then ‘ manager ’ to Emerson and now to Ayrton Senna — a fringe career from which Domingos , hugely personable , but also often more a talker than a doer , has made a more than reasonable living . |
2 | Ellwood put his mouth close to the old man 's ear and whispered , showing his teeth . |
3 | Donna got to her feet , still keeping low , and moved towards the small round window close to the front door in the hall . |
4 | In line with her injuries , her Policy paid out a benefit close to the maximum amount payable . |
5 | In Navli , a prosperous village close to the famous cooperative Amul Dairy in Gujarat , irrigation , cash crop farming and animal husbandry have made several families very rich . |
6 | In the winter he plays with some of them most weeks , either at Oswestry or Aberdovey , where he has a mobile home close to the first tee . |
7 | She turned into the drive of the Red House , and brought the car to a halt close to the front door . |
8 | Kicking and bucking to keep her balance , she managed to draw to a shuddering halt close to the rushing torrent about ten feet below where he was standing . |
9 | The other sniper was crouched behind a rusted workbench close to the main doorway . |
10 | Similar results have also been obtained from Skjomen , a fjord close to the polar circle , and for Ullsfjorden , north of Tromsø . |
11 | One group in particular , The Himba , a nomadic tribe , provided guides for Kirsten to take part in a tough 200km trek close to the Angolan border . |
12 | Even in these situations , however , first generation Caribbeans are more likely to use a variety close to the local Standard English of their birthplace than the Creole , while the second generation are much more likely to use London English than a form of Creole . |
13 | From the window of the Administration block overlooking the open ground of the camp close to the inner gates , the Major watched as the prisoners were again lined in fives and counted , a necessary formality because this marked their passing from the charge of the MVD transport guard into the hands of the MVD Correctional Labour Detachment . |
14 | They built a house , the Villa Eugénie , which eventually grew into the present Hôtel du Palais , a vast building close to the lush sands of the Grande Plage ( formerly known as the Plage tea Fous , because only the reckless , if not the insane , were thought likely to risk swimming there ) , very monumental and with a tricolour flying above it , as if it were some government department rather than merely a hotel . |
15 | The site of the Unfair is an old industrial building close to the main train station in Ehrenfeld , a section of Cologne slightly outside the centre , but still close to the main gallery district , the Belgischen Viertel . |
16 | Turn the top 2cm ( ¾in ) of curtain and lining over the top edge of the buckram , then tack and machine it in place close to the folded edge ( fig. 32 ) . |
17 | Yet when it was proposed to erect a massive ‘ brick man ’ , designed by sculptor Anthony Gormley and funded by a band of enthusiasts , on a derelict site close to the main railway line into Leeds , the local authority took fright and vetoed the idea . |
18 | A favourite spot for horse-riders , ramblers and walkers , the right of way which runs in a straight line from a point close to the Royal Naval School comes out at the Hindhead gibbet . |
19 | Situated at a superb vantage point close to the Royal Palace on Dam Square and Amsterdam 's famous shopping areas , the Ascot offers exceptional standards of comfort and service for its 4 star rating . |
20 | In addition , there is evidence from the work of Hamilton and Small that cholesteryl oleate molecules incorporated into model membranes are aligned with the carbonyl group close to the aqueous interface and the sterol ring and fatty acyl chain parallel to the acyl chains of phospholipid , thereby exerting a disordering effect . |
21 | Clearly a zero near the imaginary axis gives a minimum in the frequency spectrum at a pulsatance equal to the imaginary part of the zero point , while a pole close to the imaginary axis causes a similar maximum in the spectrum . |
22 | For example , the written sentence My next destination is Finland and in particular Kuusamo , which is a town close to the Soviet border might be spoken I 'm off to Finland next . |
23 | The aim of Operation Market Garden was to secure a bridgehead at Arnhem , a Dutch town close to the Germnan border . |
24 | Orton and Vera said they had been abducted by Malawian agents during a visit to a Zambian town close to the Malawian border . |
25 | Although platinum traded in a narrow band close to the depressed levels of 1991 , rhodium fell steadily throughout the year to finish at a three year low . |
26 | He was their paying guest and had been since that afternoon seven years ago when he had tracked Rachel Gebler down to her home in this seaside suburb close to the famous swimming beaches . |
27 | Intrinsic DNA curvature was generally thought to originate from periodically repeating AnTm tracts ( n+m≥ 3 ) , with a period close to the helical repeat length . |
28 | The effect of the GC step in the context of GGGCCC motif seems to be about as large as that of AA/TT , i.e. it is apparently enough to cancel the macroscopic curvature of helically phased A-tracts.The origin of the macroscopic curvature for the ( AGGGCCCTAGAGGGGCCCTAG ) n DNA can be explained by an overall roll angle difference between the GGGCCC and CTAGAG sequence elements , which will add up if the two motifs are separated by a distance close to the helical repeat length . |
29 | It is also possible to analyse , in a very similar way , the behaviour close to homoclinic orbits involving the stationary points C+ and C { 10 } , and , indeed , the behaviour close to the special point X on Fig. 6.2 , which represents parameter values at which all three stationary points are connected by heteroclinic orbits { 11 } . |
30 | But some modern valves have a small adjusting screw close to the actual valve mechanism . |