Example sentences of "we [verb] that [art] [adj] " in BNC.
Next page| No | Sentence |
|---|---|
| 1 | We regret that no personal correspondence can be entered into without a stamped-addressed envelope . |
| 2 | Nevertheless the subject was not forgotten , and we agreed that the average funeral was a complete waste of money which , instead of mourning the dead , should be spent on celebrating their lives . |
| 3 | We agreed that the prime minister had now definitely lost the coming election . |
| 4 | so we agreed that the next time a priest was around |
| 5 | After talks with BR 's Chairman , Peter Parker , we agreed that the sensible way forward was for a new company , British Rail Investments , to be formed and for the subsidiaries to be transferred to the private sector , with the proceeds going to British Rail . |
| 6 | When we submitted our first Report on the primary stages we recommended that the three profile components , speaking and listening , reading and writing , should be weighted equally in the assessment process . |
| 7 | As directors of WHO non-communicable disease collaborating centres and key officials in centres for non-communicable diseases we declare that a concerted global action needs to be initiated to develop national and regional infrastructures to alleviate the financial expense and cost in human suffering from non-communicable diseases in the next millennium . |
| 8 | When we first cloned the human globin genes we realised that every cloned gene is person-specific , and therefore contains the particular sequences that instruct most of the features which we inherit and that determine our individuality . |
| 9 | How little we realised that the front line was a focus , that it was important to the Lebanese , the only way to define the undefinable , the only method by which those who had suffered — which meant every Lebanese — could uniquely understand the nature of the calamity that had come upon them . |
| 10 | After snarling a few choice remarks at them from the corners of our mouths , such as , ‘ Get lost ! ’ or ‘ Beat it ! ’ , which we understood to be good American for , ‘ Please go away , we do not wish for company , ’ we managed to rid ourselves of a few of them , but two of the most persistent followed us until we were clear of the town , and then we realised that the only way to be left alone was for us to be really rude . |
| 11 | ‘ We realised that the whole psychology of collecting is a fascinating area and that it had a lot more potential … hence the reason for the Festival . |
| 12 | That is when we realised that the materialistic gap between the rich and poor was indeed nothing compared to the wide gulf in understanding , and that the understanding of health problems in this country would take a long painstaking process of re-accumulating the evidence . |
| 13 | In Chapter 9 we argued that a private monopolist would make higher profits if it were possible to price-discriminate , charging different prices to customers whose demand curves were effectively distinct . |
| 14 | Right from the beginning , we argued that the revolutionary process in El Salvador could only be carried out through a popular war in which the incorporation of the civil population is essential When we take over a village or settlement and the enemy forces are ousted … we begin the work of consciousness raising about the situation of the country together with the work of organizing the local population . |
| 15 | In the previous section we argued that the cereal-packet image of family life in modern Britain was seriously misleading in that , at any one time , relatively few families conform to the image and many households never do . |
| 16 | We argued that the critical requirements in an INSET programme are that the very diverse needs of different teachers be recognized and addressed , that teachers themselves be central to the process of defining their needs , and that diverse needs be met by diverse provision , in respect of not just content and level but also style and venue . |
| 17 | We do this because we fear that the other language may not contain the sophisticated concepts we may need in the communication . |
| 18 | ‘ We fear that the major call-up … could , instead of helping to prevent violence , lead to serious intimidation of local communities and even more violence , ’ the ANC said . |
| 19 | We postulate that the supradiaphragmatic segment of transposed colon has evolved a MAC type activity in an attempt to overcome the ‘ obstructive ’ effect of the diaphragmatic hiatus . |
| 20 | With this philosophy in mind , we postulate that the divergent process is the worst possible . |
| 21 | Yes , if by this we mean that a third party could urge this on the dog 's behalf and that sanctions of the law might well ensue . |
| 22 | His argument would be that most electronic circuits are organized interactively , by which we mean that the proper operation of one component depends on the normal operation of all of the others . |
| 23 | We realized that the unfortunate Wopsle had no understanding of the law , or indeed anything at all . |
| 24 | In a previous paper we reported that the repeating sequence 5'AGGGCCCTAGAGGGGCCCTAG3' displays an anomalous gel mobility , characteristic for curved DNA , even in the absence of AnTm tracts ( 4 ) . |
| 25 | In view of its clear advantages over the other lasers , whose rate of energy delivery does not match the predicted physical behaviour of the blood vessels , we suggest that the pulsed dye laser should be offered as the first line treatment for portwine stains whenever possible . |
| 26 | To the extent to which it makes sense to speak of interactions between whole nations at all , we suggest that the two superpowers and their allies may indeed be playing something like the paranoids ' hypergame . |
| 27 | Because of considerable conservation of RNA polymerase domains and critical sites we suggest that the two identified genes correspond to RNA polymerase subunits of ASFV . |
| 28 | We suggest that the mere passage of RTW laws will not eradicate unions that are already established : they will continue to extract a rent associated with the wage differential . |
| 29 | We suggest that the minimum target audience would be teachers in the same neighbourhood in schools with exactly the same computer system and available software utilities . |
| 30 | We suggest that the high-velocity maser emission in NGC4258 might be from masers orbiting a massive central black hole , or ejected in a bipolar outflow . |