Example sentences of "but not the [noun] [noun sg] " in BNC.
Next pageNo | Sentence |
---|---|
1 | The drawing fee should include the fees for planning permission , if applicable ; and the Building Regulations full plans application ( but not the inspection fee ) . |
2 | Dr McGarry claimed Alliance had been snubbed by the US visitors and said : ‘ Mr Morrison 's credibility as a supposedly independent observer must be called into question when he finds it important to meet Sinn Fein , a party which appears to condone the murder of Irish people , but not the Alliance Party , the foremost advocate of peace . ’ |
3 | Addition of anti-peptide A , but not the preimmune serum , causes either a supershift and concomitant reduction in DRTF1a , b and c ( Fig. 2 b , antiserum 3 ; compare tracks 1 and 2 ) or abolishes all DRTF1 complexes ( Fig. 2 b , antiserum 4 ; compare tracks 5 and 6 ) . |
4 | But not the water gymnastics or the 5 o'clock jog for those who like it hot ! |
5 | But he needs cuts to announce on Wednesday — an end to some bizarre farm subsidies to anyone running cattle on federal land , or cuts in the super-collider programme , but not the space station . |
6 | See if I can find you a picture of a of a , I 've got a picture of a Roman legionnaire here but not the standard bearer . |
7 | You get the text but not the menu bar |
8 | Powell-Tuck found no significant correlation between the erythrocyte sedimentation rate and sigmoidoscopic appearance in patients with ulcerative colitis and in Crohn 's disease Cooke and Prior showed that serum C-reactive protein and albumin but not the erythrocyte sedimentation rate correlated with disease activity . |
9 | we pay the rec reconnection fee , but not the electricity bill . |
10 | No hybridization to mouse intestine was detected with either of two human CFTR probes whereas , in consecutive sections , the mouse antisense cftr probe ( but not the sense probe ) detected abundant cftr mRNA in the crypts ( data not shown ) . |
11 | The quality of the poetry might have left something to be desired , but not the subject matter . |
12 | Our data suggest that the major groove-directed curvature of ( AGGGCCCTAGAGGGGCCCTAG ) n DNA is caused in fact by the GGGCCC , but not the CTAGAG motif . |
13 | Yes , the Milk race , but not the round-Britain cycle race . |
14 | A porous polymer membrane bag seals the electrolyte , allowing water vapour , but not the acid solution , to pass . |
15 | The existence of such a market guarantees the reversibility of such a claim but not the disposal price or value . |
16 | And they said May which we thought was it a bit really but they said it had the the Spring wood but not the Summer wood on it . |
17 | They 're good rock garden plants , given a well-drained spot which gets some sun , but not the mid-day sun . |
18 | I had the feeling I had been given most of the pieces , but not the boxfront picture to tell me how to put them together . |
19 | When they had gone and the noise of the engines had faded away , all would be quiet for a few hours and most people on night duty could relax — but not the Met Office , of course . |
20 | A Land Rover mechanic replaced the stabiliser unit behind the dash — the fuel gauge worked again but not the temperature gauge . |
21 | She used the soap , but not the scrubbing brush . |