Example sentences of "and [adv] in the [noun prp] " in BNC.
Next page| No | Sentence |
|---|---|
| 1 | Finally we breasted the saddle in the lower ridge , what in the Welsh mountains , and latterly in the Himalayas , we would call the cwm . |
| 2 | ‘ I am particularly pleased that , as part of the development , the Morayhill factory will become a major administrative centre for Norbord , as it is further proof that the advanced telecommunications network in this area enables companies to carry out office functions efficiently and cost-effectively in the Highlands and Islands . ’ |
| 3 | On the other hand in the Lepidoptera and other Panorpoid orders the prolegs appear to have arisen independently in each group , they are absent or lack muscles in the more primitive Panorpoids , and only in the Lepidoptera do they become important locomotor structures ( Hinton , 1955 ) . |
| 4 | The main thrust of the Government 's policy is contained in the January 1988 White Paper on Regional Policy and the Enterprise Economy , in the new Employment Training programme , and especially in the March 1988 Action for Cities programme — all resting on wider reforms to local government structure and finance , and to education and housing . |
| 5 | The mineralisation is of SEDEX type ( Large , 1983 ) with stratabound sulphates , silicates and sulphides occurring in small , third order basins within the Middle Dalradian and especially in the Ben Eagach Schist Formation ( Coats and others , 1980 ) . |
| 6 | But the Hillsborough Agreement made Mrs Thatcher look credible and constructive over Northern Ireland in the eyes of world opinion , and especially in the United States . |
| 7 | But in any election , and especially in the United States with its complicated voting system , a small shift can make a crucial difference . |
| 8 | The family was of some eminence in Hull and especially in the Hull Trinity House . |
| 9 | Some fields were probably cultivated only in the dry season and generally in the Veracruz wetlands there may not have been the intensive year-round agriculture as practised in the upland chinampas |
| 10 | He did not disclose the substance of the Libyan suggestions but a delegate at the meeting told Reuters : ‘ Libya 's proposals are still along the lines of its known positions , that the two could be tried only in a third country and not in the United States or Britain . ’ |
| 11 | If this is the case , you may be taxed on the income in your new residence — and not in the UK . |
| 12 | Considering the published data of AG/CT , TA , GG/CC and GC wedge-roll values ( 1,6 ) , the preferential curvature of PyPu ( TA ) , compared to PuPy ( GC ) steps ( 12 ) and crystallographic data ( 10,11 ) , we expected that the region with the major groove-directed curvature is located in the CTAGAG , and not in the GGGCCC part of the curved ( AGGGCCCTAGAGGGGCCCTAG ) n DNA ( 4 ) . |
| 13 | ‘ No , Margaret is not as old as that , and not in the WAAF . ’ |
| 14 | JANET facilitates direct access to other university computers in London , Manchester , Cambridge and elsewhere in the UK and overseas . |
| 15 | Research projects on many topics are carried out at the CTVM , overseas , and elsewhere in the Edinburgh area and students and staff present their work at weekly seminars . |
| 16 | Each year we review the cost of Friends subscriptions and take into account the level of admission charges at Historic Scotland properties , the costs charged by comparable organisations in Scotland and elsewhere in the United Kingdom and the service we provide to Friends . |
| 17 | My right hon. Friend may have read reports in the newspapers today that the European Commission wants to abolish newspaper boys and girls in Cumbria and elsewhere in the United Kingdom . |
| 18 | A third defendant , John Kinsella ( 48 ) an uncle of Denis Kinsella , who also lives in the Nottingham area , is charged with the other two with conspiracy to cause explosions on or before February 26 in Warrington and elsewhere in the United Kingdom . |
| 19 | Similarly skilful pastiches of interior decorative styles included work at Hackwood ( 1807–13 ) and Lyme Park , Cheshire ( 1814–17 ) , in an English late seventeenth-century manner , and at Hawkstone Hall , Shropshire ( 1832–4 ) , and elsewhere in the Louis XIV mode particularly associated with his cousins Benjamin [ q.v. ] and Philip Wyatt . |
| 20 | Whatever the findings on relocation , there may well be an impact on the level of unleaded petrol sales in Scotland and thus in the United Kingdom . |
| 21 | Certainly Sir John , a shrewd and amiable man , was anxious to do so , but Michael Foot — one of Crossman 's literary executors and thus in the Crossman camp — felt that a compromise would have been a capitulation and contrary to their obligations to his memory . |
| 22 | And finally in the Thirsk area there are no further reports of snow on the high ground there but some moorland routes may still be a little slippery . |
| 23 | A liquidator was called in on March 25 1905 , and finally in the August all 600 men ( at the company 's height it had employed 800 ) were paid off and sent home . |
| 24 | And finally in the Ripon area weekend roadworks mean the Road will be closed as it passes under the A one bridge and delays are likely . |
| 25 | Before that he had worked as GM in Brazil , exploring a portfolio of acreage which included the great tracts of land in which BP was an interest holder in the middle Amazon basin as well as onshore blocks in the Parana Basin and offshore in the Sergipe Alagoas Basin . |
| 26 | This competition is open to all readers of Wedding and Home in the UK and Eire , except those in any way involved in the competition . |
| 27 | This competition is open to all readers of Wedding and Home in the UK and Eire , except those in any way involved in the competition . |
| 28 | To the east of Palazzo Reale , and still in the Piazza del Duomo , is the Palazzo Arcivescovile . |
| 29 | Forest Wind made a spectacular debut when hammering his rivals by 10 lengths and more in the Vodapage Maiden Stakes at Goodwood . |
| 30 | The society claims , however , that recent votes show it has 3-1 support in the House of Lords and more in the Commons . |