Example sentences of "we [vb past] [that] the [noun] " in BNC.
Next pageNo | Sentence |
---|---|
1 | In the end , EGBT were willing to put in more money for a more environmentally-friendly mode of working , and we agreed that the planings would be off-loaded at the end of the path , and then ferried in on dumper trucks . |
2 | Because the money did n't matter now , and our games were more evenly and bitterly fought , and we agreed that the rivalry should n't — and indeed could n't — get any tenser . |
3 | We agreed that the man or woman does not exist who had never made a mistake , however foolish . |
4 | We agreed that the accusation was obviously nonsense , but I warned him that rape , like child abuse , was a powerfully charged topic at present in England . |
5 | Because you know money-wise because we were not content to sit back and see er schemes being introduced that , which were going to act as a deterrent to er our members er being able to earn wages er on incentives and so therefore erm what happened was that we agreed that the consultants er head personnel manager would come down and talk to each group of people who were being put on to the incentive scheme , one , in order that he go over everything with them in regard to its application , and two , then answer any practical questions er where our members may find that there could be difficulties . |
6 | We agreed that the lack of action was an outrage and that we had to draw people 's attention to it . |
7 | We agreed that the wedding would be in ten days ’ time . |
8 | ‘ We agreed that the terms of the Edict would not apply to the starship . ’ |
9 | We agreed that the piano should not be put in our part of the attic . |
10 | We hypothesised that the patients with cholesterol gall stones have less metastable hepatic bile which would become more lithogenic during the storage in the gall bladder . |
11 | After a while we realised that the girders were not a skeleton for something fancier but the thing itself . |
12 | NOW the European Community mandarins have gone their separate ways after yet another costly weekend of squabbling and arm-twisting , it 's time we realised that the nations which form what was once called The Common Market actually have very little in ‘ common ’ at all . |
13 | In the accompanying letter we requested that the sample be run out on their typesetter in order to satisfy a client that they were competent to handle a monthly four page newsletter for our mythical client on a 48-hour turn-round basis . |
14 | Considering the published data of AG/CT , TA , GG/CC and GC wedge-roll values ( 1,6 ) , the preferential curvature of PyPu ( TA ) , compared to PuPy ( GC ) steps ( 12 ) and crystallographic data ( 10,11 ) , we expected that the region with the major groove-directed curvature is located in the CTAGAG , and not in the GGGCCC part of the curved ( AGGGCCCTAGAGGGGCCCTAG ) n DNA ( 4 ) . |
15 | Pricing for the job was requested by a specified date and we asked that the disk be returned . |
16 | We argued that the ownership of this form of property and its effect — wealth — is the defining feature of the dominant or upper class . |
17 | When we complained , we had quite a battle with the manager of the firm , but we argued that the fridge was not in use all the time , and if it had been in our home the fault may have occurred earlier . |
18 | In brief , we argued that the primates could be classified into five grades of socio-ecological adaptation ( see also Table 4.1 ) ; |
19 | We argued that the sickness or crisis of capitalism was not at heart a technical matter but a lack of legitimacy with respect to the system itself . |
20 | We argued that the sickness or crisis of capitalism was not at heart a technical matter , but a lack of legitimacy with respect to the system itself . |
21 | In the case of cells that absorbed at short wavelengths , we checked that the pigment was photolabile by repeating the absorbance measurements after bleaching the cell with white light for 5min . |
22 | and we presumed that the redemption would be no more than twenty percent which was pretty high for a promotion . |
23 | At the conclusion of that argument we announced that the judge 's order would be set aside and the application refused for want of jurisdiction . |
24 | And the more critical we became , the more we realized that the government might attack us . |
25 | When , however , we took time out and discussed it , we realized that the fact that we were more diverse offered us a strength against our competitors if we could only capitalize on it . |
26 | In July , we reported that the Trust had donated £400,000 towards the cost of improving library facilities at the University . |
27 | ( see p 110 ) we reported that The Companies ( Single Member Private Limited Companies ) Regulations 1992 had come into force , and referred to the various aspects of company and insolvency law that had been changed to accommodate the single-member company . |
28 | In the previous section we mentioned that the programmer using fixed-point binary format could consider the binary point to be at an appropriate position in the word for each item of data . |
29 | Later reports from the IBM Corp annual meeting in Tampa , Florida on Monday stress the anger of shareholders that we forecast when we mentioned that the meeting was to be held in America 's retirement capital : ‘ IBM stock no longer provides for your old age , but it certainly hastens its arrival , ’ one irate shareholder told Louis Gerstner during the annual meeting ; some 2,300 shareholders , mostly elderly investors and current or former IBM employees , crowded into the Tampa Convention Center for the meeting . |
30 | We found that the output of the Wasp and the Forgen in.particular , was tiny . |