Example sentences of "we [verb] [conj] the [noun sg] " in BNC.
Next pageNo | Sentence |
---|---|
1 | Notes We regret that the tour is not entirely suitable for people in wheelchairs . |
2 | ‘ We regret that the Department has encouraged parents to expect schools to report to them using these measurements so prematurely . |
3 | Because the money did n't matter now , and our games were more evenly and bitterly fought , and we agreed that the rivalry should n't — and indeed could n't — get any tenser . |
4 | We agreed that the man or woman does not exist who had never made a mistake , however foolish . |
5 | We agreed that the accusation was obviously nonsense , but I warned him that rape , like child abuse , was a powerfully charged topic at present in England . |
6 | We agreed that the lack of action was an outrage and that we had to draw people 's attention to it . |
7 | We agreed that the wedding would be in ten days ’ time . |
8 | We agreed that the piano should not be put in our part of the attic . |
9 | And we stress that the absence of noticeable discriminatory behaviour says nothing about how defendants perceived their treatment . |
10 | We stress that the list serves a heuristic purpose : it enables us to collect data on a fairly systematic basis . |
11 | We may scrape and spit and dab and rub , until the point when we declare that the truth stands plain before us , thanks to xylene and propanol and acetone . |
12 | Integrity becomes a political ideal when we make the same demand of the state or community taken to be a moral agent , when we insist that the state act on a single , coherent set of principles even when its citizens are divided about what the right principles of justice and fairness really are . |
13 | More and more sprays and chemicals have been used on the food we eat and the land on which it is grown and ingenious methods of preserving the appearance of freshness have been devised . |
14 | We have suggested that ‘ diata ’ means a way of living ; it means taking a holistic viewpoint on the food we eat and the exercise our bodies need . |
15 | This water is not only derived from the food that we eat and the fluid that we drink : much of it comes from the multitude of secretions which enter the gut lumen . |
16 | Small changes in the choices we make or the way we behave can make us part of the solution rather than the problem . |
17 | We require also to recruit and motivate the best people and this in turn requires a good reputation , not only for the goods we make and the worthiness of our contribution to society , but also the way in which we do these things , the sort of people we employ and the contributions we make in the area , and whether we are good citizens or not . |
18 | In the accompanying letter we requested that the sample be run out on their typesetter in order to satisfy a client that they were competent to handle a monthly four page newsletter for our mythical client on a 48-hour turn-round basis . |
19 | Er we trust if the post is doubled in the way it has frequently been in recent years and indeed was in my case , the Chancellor of the Duchy in brackets also as the Chairman of the Conservative Party to maintain the dignitary of the magistracy to make sure that there is a firm balance amongst magistrates who are appointed . |
20 | Meanwhile we should perhaps consider what state we would be in , were we to agree that the sceptic 's argument is effective . |
21 | The ball came over the wire as we passed and the German who was escorting me threw it back . |
22 | Considering the published data of AG/CT , TA , GG/CC and GC wedge-roll values ( 1,6 ) , the preferential curvature of PyPu ( TA ) , compared to PuPy ( GC ) steps ( 12 ) and crystallographic data ( 10,11 ) , we expected that the region with the major groove-directed curvature is located in the CTAGAG , and not in the GGGCCC part of the curved ( AGGGCCCTAGAGGGGCCCTAG ) n DNA ( 4 ) . |
23 | Pricing for the job was requested by a specified date and we asked that the disk be returned . |
24 | ‘ The only good news we got after the game was the fact that Middlesborough lost . |
25 | We argued that the ownership of this form of property and its effect — wealth — is the defining feature of the dominant or upper class . |
26 | When we complained , we had quite a battle with the manager of the firm , but we argued that the fridge was not in use all the time , and if it had been in our home the fault may have occurred earlier . |
27 | We argued that the sickness or crisis of capitalism was not at heart a technical matter but a lack of legitimacy with respect to the system itself . |
28 | We argued that the sickness or crisis of capitalism was not at heart a technical matter , but a lack of legitimacy with respect to the system itself . |
29 | The champagne went down very well on the night the Tobacco Institute of Australia 's appeal substantially failed , but we fear that the hangover from this report may last rather longer . |
30 | ‘ We fear that the construction of a sea defence wall will pave the way for road and business developments and will signal the end of Southport as a resort . ’ |