Example sentences of "but not the [noun sg] [noun] " in BNC.
Next page| No | Sentence |
|---|---|
| 1 | The drawing fee should include the fees for planning permission , if applicable ; and the Building Regulations full plans application ( but not the inspection fee ) . |
| 2 | Dr McGarry claimed Alliance had been snubbed by the US visitors and said : ‘ Mr Morrison 's credibility as a supposedly independent observer must be called into question when he finds it important to meet Sinn Fein , a party which appears to condone the murder of Irish people , but not the Alliance Party , the foremost advocate of peace . ’ |
| 3 | Addition of anti-peptide A , but not the preimmune serum , causes either a supershift and concomitant reduction in DRTF1a , b and c ( Fig. 2 b , antiserum 3 ; compare tracks 1 and 2 ) or abolishes all DRTF1 complexes ( Fig. 2 b , antiserum 4 ; compare tracks 5 and 6 ) . |
| 4 | But not the water gymnastics or the 5 o'clock jog for those who like it hot ! |
| 5 | In chapter 13 the Group suggests that , for pupils taught mainly through the medium of Welsh , the programmes of study but not the attainment targets for English in key stage 2 will need modification , to accommodate the matters , skills and processes which have been included in the English programmes of study for key stage 1 but have been disapplied in respect of such pupils in key stage 1 . |
| 6 | But he needs cuts to announce on Wednesday — an end to some bizarre farm subsidies to anyone running cattle on federal land , or cuts in the super-collider programme , but not the space station . |
| 7 | See if I can find you a picture of a of a , I 've got a picture of a Roman legionnaire here but not the standard bearer . |
| 8 | The towns accepted the new time , but not the country areas . |
| 9 | ‘ We can accept the white silk sheets that your mistress sent , but not the painting Tony sent ! ’ |
| 10 | You get the text but not the menu bar |
| 11 | Powell-Tuck found no significant correlation between the erythrocyte sedimentation rate and sigmoidoscopic appearance in patients with ulcerative colitis and in Crohn 's disease Cooke and Prior showed that serum C-reactive protein and albumin but not the erythrocyte sedimentation rate correlated with disease activity . |
| 12 | we pay the rec reconnection fee , but not the electricity bill . |
| 13 | No hybridization to mouse intestine was detected with either of two human CFTR probes whereas , in consecutive sections , the mouse antisense cftr probe ( but not the sense probe ) detected abundant cftr mRNA in the crypts ( data not shown ) . |
| 14 | The quality of the poetry might have left something to be desired , but not the subject matter . |
| 15 | After another round of serious negotiations the ARC finally agreed to release the report , the hard statistical evidence , but not the case studies , the interpretation of which they did not consider to be ‘ objective . ’ |
| 16 | The NHS needed reform but not the government changes . |
| 17 | He said that the Government had only pledged itself to employ the successful barracks architects , but not the Government Offices architects . |
| 18 | Our data suggest that the major groove-directed curvature of ( AGGGCCCTAGAGGGGCCCTAG ) n DNA is caused in fact by the GGGCCC , but not the CTAGAG motif . |
| 19 | Here we show , using hydroxy radical/ DNase I digestion and differential helical phasing experiments that the curvature is directed towards the major groove and is located in the GGGCCC , but not the CTAGAG segments . |
| 20 | For instance , the manufacturing wages are down , but not the office staff . |
| 21 | A porous polymer membrane bag seals the electrolyte , allowing water vapour , but not the acid solution , to pass . |
| 22 | The existence of such a market guarantees the reversibility of such a claim but not the disposal price or value . |
| 23 | And they said May which we thought was it a bit really but they said it had the the Spring wood but not the Summer wood on it . |
| 24 | Property rights , in this case whether you are legally entitled to compensation for loss of light to your garden , determine who compensates whom but not the outcome S * of the bargain . |
| 25 | But not the Tiger Fish , or Mud Characin , Hoplias malabaricus . |
| 26 | They 're good rock garden plants , given a well-drained spot which gets some sun , but not the mid-day sun . |
| 27 | I had the feeling I had been given most of the pieces , but not the boxfront picture to tell me how to put them together . |
| 28 | When they had gone and the noise of the engines had faded away , all would be quiet for a few hours and most people on night duty could relax — but not the Met Office , of course . |
| 29 | ‘ It is disappointing to see that he heeded the whisky lobby but not the wine merchants who must be very disappointed with the rise , ’ he said . |
| 30 | A Land Rover mechanic replaced the stabiliser unit behind the dash — the fuel gauge worked again but not the temperature gauge . |