Example sentences of "but not [art] [noun] [noun sg] " in BNC.
Next page| No | Sentence |
|---|---|
| 1 | But not every intelligence agency is as fortunate as was the DGSE . |
| 2 | A typical manufacturing company will have functional activities such as ‘ manufacturing ’ , ‘ engineering ’ and ‘ sales ’ , but not every manufacturing company may need these functional divisions , and some may need to emphasise other functions as well . |
| 3 | If what is proposed is not ‘ development ’ , the ‘ developer ’ does not have to worry , but not every planning officer or outside adviser always checks this first . |
| 4 | Although the two Korean states remained technically in a state of war ( the hostilities having been ended in 1953 by an armistice but not a peace treaty ) , many commentators felt that the December agreements laid a realistic foundation for the negotiation of a full peace treaty . |
| 5 | As the attribute ‘ lecturer ’ is a determinant but not a candidate key , it is necessary to create a new table containing ‘ lecturer ’ and its directly dependent attribute ‘ module ’ . |
| 6 | With a videocassette recorder ( but not a video player ) you can record off-air . |
| 7 | Noah was a charity-boy , but not a workhouse orphan ; he at least knew who his parents were . |
| 8 | Severe forearm bruising may be covered with both a crêpe bandage and a shin pad ( but not a shin/instep protector ) . |
| 9 | It can also make a s8 order in addition to a supervision order but not a care order . |
| 10 | It then went into the City to set up their own self-regulatory and we in fact went to see Mr Redwood and he was quite he was very quite blunt about it , he said well , they considered it when they were sid considering the investors compensation scheme , but the sum involved in pensions are so great , that they could not afford to underwrite a pension er a compensation fund for pensions , so therefore there 's a pension fund for for private investment , but not a pension fund er compensation fund for , for occupation . |
| 11 | No the only , I would say personally , I would say the best dredging method is buckets because you can , you can keep a level , you could keep a level with a sucker dredger but not a ground dredger unless like grabbing out the hole . |
| 12 | Not bad , but not a matinee idol or anything . |
| 13 | The drawing fee should include the fees for planning permission , if applicable ; and the Building Regulations full plans application ( but not the inspection fee ) . |
| 14 | Dr McGarry claimed Alliance had been snubbed by the US visitors and said : ‘ Mr Morrison 's credibility as a supposedly independent observer must be called into question when he finds it important to meet Sinn Fein , a party which appears to condone the murder of Irish people , but not the Alliance Party , the foremost advocate of peace . ’ |
| 15 | Addition of anti-peptide A , but not the preimmune serum , causes either a supershift and concomitant reduction in DRTF1a , b and c ( Fig. 2 b , antiserum 3 ; compare tracks 1 and 2 ) or abolishes all DRTF1 complexes ( Fig. 2 b , antiserum 4 ; compare tracks 5 and 6 ) . |
| 16 | But not the water gymnastics or the 5 o'clock jog for those who like it hot ! |
| 17 | But he needs cuts to announce on Wednesday — an end to some bizarre farm subsidies to anyone running cattle on federal land , or cuts in the super-collider programme , but not the space station . |
| 18 | See if I can find you a picture of a of a , I 've got a picture of a Roman legionnaire here but not the standard bearer . |
| 19 | You get the text but not the menu bar |
| 20 | Powell-Tuck found no significant correlation between the erythrocyte sedimentation rate and sigmoidoscopic appearance in patients with ulcerative colitis and in Crohn 's disease Cooke and Prior showed that serum C-reactive protein and albumin but not the erythrocyte sedimentation rate correlated with disease activity . |
| 21 | we pay the rec reconnection fee , but not the electricity bill . |
| 22 | No hybridization to mouse intestine was detected with either of two human CFTR probes whereas , in consecutive sections , the mouse antisense cftr probe ( but not the sense probe ) detected abundant cftr mRNA in the crypts ( data not shown ) . |
| 23 | The quality of the poetry might have left something to be desired , but not the subject matter . |
| 24 | Our data suggest that the major groove-directed curvature of ( AGGGCCCTAGAGGGGCCCTAG ) n DNA is caused in fact by the GGGCCC , but not the CTAGAG motif . |
| 25 | Yes , the Milk race , but not the round-Britain cycle race . |
| 26 | A porous polymer membrane bag seals the electrolyte , allowing water vapour , but not the acid solution , to pass . |
| 27 | The existence of such a market guarantees the reversibility of such a claim but not the disposal price or value . |
| 28 | And they said May which we thought was it a bit really but they said it had the the Spring wood but not the Summer wood on it . |
| 29 | They 're good rock garden plants , given a well-drained spot which gets some sun , but not the mid-day sun . |
| 30 | I had the feeling I had been given most of the pieces , but not the boxfront picture to tell me how to put them together . |