Example sentences of "and not [prep] the [noun prp] " in BNC.
Next pageNo | Sentence |
---|---|
1 | Special care he reserved for his own wife and not for the Mrs Strawsons of this world . |
2 | This extra bonus applies only to the war boar and not to the Orc rider . |
3 | Years later , when they told this story , those who had conceived the plan insisted that they would have carried out the attack in their own names , as rebels , and not under the Shah 's authority . |
4 | He did not disclose the substance of the Libyan suggestions but a delegate at the meeting told Reuters : ‘ Libya 's proposals are still along the lines of its known positions , that the two could be tried only in a third country and not in the United States or Britain . ’ |
5 | If this is the case , you may be taxed on the income in your new residence — and not in the UK . |
6 | Considering the published data of AG/CT , TA , GG/CC and GC wedge-roll values ( 1,6 ) , the preferential curvature of PyPu ( TA ) , compared to PuPy ( GC ) steps ( 12 ) and crystallographic data ( 10,11 ) , we expected that the region with the major groove-directed curvature is located in the CTAGAG , and not in the GGGCCC part of the curved ( AGGGCCCTAGAGGGGCCCTAG ) n DNA ( 4 ) . |
7 | ‘ No , Margaret is not as old as that , and not in the WAAF . ’ |
8 | However , a report in Le Monde on April 16 alleged that the group had actually been seized much earlier than originally thought , probably during 1986 , and not by the FRC , but by the Libyan Navy . |