Example sentences of "[was/were] use [verb] [art] [noun] " in BNC.
Next pageNo | Sentence |
---|---|
1 | It was littered with ladders , pails and other decorators ' paraphernalia and the air was permeated with the odour of the chemical the workmen were using to strip the woodwork . |
2 | Buthelezi criticized the action as " confrontationist " , while the police claimed that intimidatory tactics were used to implement the strike . |
3 | χ 2 and Wilcoxon rank sum tests were used to compare the characteristics of the two treatment groups at randomisation . |
4 | The following primer pairs were used to analyse the expression of Oct-1 5' TTCAAGCAGAGACGCATTAAGCTAGGC 3' and 5' CTCTGCATCATTTAGCCACTTCTCTAA 3' ; Oct-2 5' TTCACACAGGGTGATGTGGG 3' and 5' CCAGCTGAGCAGCCCAG 3' , and Oct-11 5' AGTCCTCCCCGTCAGACC 3' and 5' ATCGATGGAGAAGGAGGT 3' . |
5 | The World Health Organization criteria were used to assess the degree of differentiation . |
6 | Univariate tests and multiple regression analysis were used to assess the influence of anatomic localisation of disease , sex , overall gastrointestinal symptom severity ( as defined in Table II ) , and surgical intervention on the change in SDS for height over the total period of follow up . |
7 | The discriminant functions obtained were used to predict the site of the primary tumour in the samples and the results compared with the actual primary diagnosis for each patient . |
8 | Like the county ‘ sheepdippers ’ and the borough men , both the specials and the British Transport Police were used to sustain a view of our own preeminence . |
9 | Black brown , green and blue were used to accent the drawing with sharp outline as seemed necessary . |
10 | Rubies , along with emeralds , oriental sapphires and pearls were used to enrich the brooches and gold crowns owned by Edward I 's wife , Eleanor of Castile , at the time of her death in 1290 . |
11 | If either of these methods were used to estimate the distance , the process would be analogous to laying matches end to end , or to walking and counting steps . |
12 | In July , 1992 , these resources were used to estimate the prevalence of HEV and hepatitis C virus ( HCV ) in Turkey . |
13 | Dakotas were used to support the operations in South West Africa against SWAPO insurgents up to the peace settlement of 1989 . |
14 | They were in demand to play fantastic or comic roles such as satyrs or jesters and were used to relieve the solemnity of late eighteenthand ninteenth-century ballets , e.g. the many jesters found in Petipa and Soviet ballets and Puck in Ashton 's The Dream . |
15 | In this evaluation study , psychometric methods were used to examine the product of the course in information retrieval . |
16 | Similar results were obtained when a rabbit anti-ribophorin I antiserum or immunoadsorbant-purified rat IgG2a monoclonal antibodies against the KDEL tetra- peptide were used to label the ER in double-labelling experiments with anti-Bcl-2 antibody ( not shown ) . |
17 | Her heart went to a 57-year-old man , her liver to a baby of eight months , her kidneys to a teenage girl and boy , and her corneas were used to save the sight of two people . |
18 | ERDAS GIS functions were used to overlay the ward boundaries on to the classified image and then count the number of pixels of each recognized land-cover type within each ward . |
19 | Sometimes , we may imagine , boundary stones or small cairns were used to mark the edge of the precinct , or a rough , low drystone wall . |
20 | ‘ Type-curves ’ corresponding to the dual porosity model were used to derive the cementation exponent values to be used in the Carboniferous evaluation ( Table 3 ) and were supported by similar plots of data logged through water saturated intervals . |
21 | There has also been malpractice in the past by officials administering the fund , he claims , in which thousands of pounds were used to foot the bill for regimental social functions . |
22 | Both words were used to push the Morrissey vision of men 's liberation ; not , as it may sound , a freedom given to the Penthouse reading hordes but a glimpse of Morrissey 's ideal world where gender barriers are entirely dispensed with . |
23 | Ideologies , such as nationalism and developmentalism , were used to counter the influence of communism . |
24 | Because of the thickness of the scrub , bulldozers were used to carry the warden using the tranquillizing dart gun within range . |
25 | Noise and lights were used to drive the starlings into an 18-foot long net suspended on two 30-foot poles and held aloft . |
26 | The restriction sites EcoRI and NcoI were used to generate the ble gene specific fragment for the run-on transciption assays . |
27 | It met the first two of the quarter-final matches head on as they tackled the shortish par-four 12th which , for a few minutes , became a monster and odd routes were used to reach the green . |
28 | When steel was being tempered , hazel twigs were used to test the metal 's heat , the stick about a foot long was rubbed on the steel . |
29 | Cochran , Mantel Haenzel statistics were used to test the association between variables ( SAS package on an IBM computer ) . |
30 | Although the entrance was less dangerous there was an additional hazard — a power cut had extinguished the leading lights needed to enter — but car headlights were used to guide the lifeboat in to land the survivors . |