Example sentences of "[was/were] [vb pp] [verb] [art] [num] " in BNC.
Next page| No | Sentence |
|---|---|
| 1 | Both measures were intended to curb the 1991 budget deficit after initial projections had put it at Rbs250,000 million . |
| 2 | Two sections ( four aircraft ) of 807 Squadron were scrambled to join the four Fulmars of 808 Squadron on patrol , these latter aircraft intercepting sixteen S.79s of 38° Gruppo from Sardinia , but as Lt. Tillard led the attack they were themselves ‘ bounced ’ by a dozen escorting CR 42s of the 3° Gruppo C.T . |
| 3 | They were expected to support the M-19 coalition . |
| 4 | Nevertheless , increased oil revenues , due to production increases and the sharp rise in prices , were expected to produce a 3 per cent growth in GDP . |
| 5 | How many , I wondered , who visited the show would realise just how much blood , sweat , and tears were shed to get the two aircraft on the ramp . |
| 6 | Primers were designed to amplify a 305 base pair product as INS 1 : 5' CGTGAGGGCATCGAGGTGGC 3' and INS 2 : 5' GCGTAGGCGTCGGTGACAAA 3' . |
| 7 | The business sales were designed to cut the 30 per cent of B&C 's borrowings which are currently under fluctuating interests rates — roughly £200 million of its overall loans . |
| 8 | Two interlocking cycles were recommended to cover the seven year primary course : |
| 9 | From the 5' region of IS902 , primers P102 ( 5'-CTGATTGAGATCTGACGC-3' ) and P103 ( 5'-TTAGCAATCCGGCCGCCCT-3' ) were selected to amplify a 252 bp fragment ( nucleotides 132–383 ) , unique to IS902 . |
| 10 | Attempts were made to sell the PC-5 to the USAAC , but they showed no interest , due to the use of strategic materials . |
| 11 | These findings are consistent with our early experience , when attempts were made to isolate a 10 cm segment of oesophagus between two occluding balloons in six subjects . |
| 12 | First , the 1981 Census of Population was not made available for grid squares and , second , our estimates were produced using a 1984 satellite image and 1981 Census ward data . |
| 13 | Later wind-tunnel experiments were performed to convert the 460 tonne schooner Buckau to a rotor ship . |
| 14 | A total of 205 N 2 progeny were obtained ; a random subset of these N 2 mice were used to map the Oct-11 loci . |
| 15 | They totalled only some 10,000 regulars , perhaps 3000 of whom were needed to hold the 38 fortified strongholds in the country , particularly Plymouth , Portsmouth and Tilbury . |
| 16 | After washing in tap water and then Tris buffer ( pH 7.3 ) for 5 minutes ( ×3 ) , sections were stained using a three stage peroxidase procedure in which Ki-67 monoclonal antibody ( 1:50 in Tris buffer ) , biotinylated rabbit anti-mouse ( 1:300 in Tris buffer ) , and avidin-biotin complex ( Dakopatts ) were applied . |
| 17 | Monsoon and his adoptive father , Balbindor , were hired to escort the two Sigmoids into the interior of Borneo . |
| 18 | Managers were asked to rank the six goals in terms of their importance to them now . |
| 19 | The guinea pigs were asked to rate the five factors on a scale of 1–5 , ranging from very comfortable to very uncomfortable for each of the 13 muscle groups involved . |
| 20 | Survey recipients were asked to complete a three page questionnaire . |
| 21 | North American Texans and Vultee Valiants were remanufactured to become the three Japanese types employed in the raid . |
| 22 | Differences in duodenal prostaglandin release were determined using a two way analysis of variance for multiple comparisons , and the Student 's t test for single comparisons . |
| 23 | However , 150 French paratroopers were sent to reinforce the 1,300 legionnaires already stationed in Chad , and over 1,600 French nationals were eventually evacuated from the country . |
| 24 | Shawcraft Models were contracted to build the three robots the budget would allow , plus the model of their city on stilts . |
| 25 | The teachers who were selected to teach the smoking and me project were required to attend a one day training seminar which familiarised them with the project guide and the group leader approach to teaching . |
| 26 | Before 1981 , these assets were known as ‘ reserve assets ’ and banks were required to hold a 12½ per cent ‘ reserve assets ratio ’ . |
| 27 | That same day he ( Searby ) was posted to command No 83 Squadron , and won renown at Peenemunde as the Master Bomber . |
| 28 | Free solution Capillary Electrophoresis ( CE ) with a UV detector ( Prime Vision , system IV , Europhor , France ) was developed using a 100 µm capillary , 60 cm in length ( 45 cm to the detector ) and TBE buffer ( 89 mM Tris , 89 mM boric acid , 2 mM EDTA , pH 8.3 ) . |
| 29 | The water from two rivers which sweep through the estate was harnessed to provide the five lakes strategically placed around the course . |
| 30 | Concorde was booked to fly a dozen executives on a two week fact finding tour of America . |