Example sentences of "[was/were] [verb] [verb] a [adj] " in BNC.
Next page| No | Sentence |
|---|---|
| 1 | Slides were developed using a Fast Red TR substrate ( Sigma ) and viewed under fluorescence conditions as described previously . |
| 2 | The portraits were arranged to form a three-dimensional family tree , and to suggest links with the imperial family in Rome . |
| 3 | The Wolverton design team continued to develop this successful system , and in 1938–39 were experimenting to develop a 30 cwt — 2 ton unit . |
| 4 | Women around the world were heard to heave a huge sigh of relief . |
| 5 | On training prisons such as Maidstone he found , generally , that most establishments were struggling to provide a basic level of regime activities . |
| 6 | The protesters were demanding to see a confidential document written by Anglian Water to the Scottish Office about the reorganisation of Scottish water . |
| 7 | The protesters were demanding to see a confidential AW document to the Scottish Office about Scottish water . |
| 8 | Incidentally , I knocked down the girders that were to go to develop a new pit which would come from Monktonhall into those reserves . |
| 9 | The kitchen and breakfast room were joined to create a spacious 22ft by 15ft area . |
| 10 | However , it would be dangerous indeed to assume that all these entrants were intended to acquire a full competence in the trade.58 Work on Essex shows that the skill and training content of female apprenticeships was generally modest , and that they tended to have a different meaning . |
| 11 | These measures were intended to introduce a new era in health and safety particularly through methods of ‘ self regulation ’ backed by a minimum of general rules . |
| 12 | They were intended to provide a rapid procedure under which objectors would have no right to state their case at a public inquiry , and the commission was not required to disclose the purpose for which the land was needed . |
| 13 | DHAs were expected to devolve a substantial measure of autonomy to units who remained directly managed so that a clear distinction was made between purchasing and providing functions . |
| 14 | Until early in the eighteenth century , moreover , foreign diplomats when given audience by the sultan were expected to wear a Turkish-style robe over their normal clothing in order to spare him the repellent sight of European dress . |
| 15 | However the long standing official policy of community care , in which social services departments were expected to play a major part was thwarted by the unforeseen consequences of financial restraint . |
| 16 | There has been a small reduction in cigarette smoking , to 1,008 per capita ; military spending fell in 1990 and figures for 1991 were expected to show a further decline ; and significantly smaller quantities of ozone-depleting chemicals are being produced ; but , disturbingly , grain production has fallen while population continues to grow at record rates . |
| 17 | Clearly Looe schoolboys were expected to have a nautical bent and those who had were promised they would ‘ … be shown to take Observations of the Sun , Moon and Stars so expeditiously and accurately as if actually at sea , Looe having the advantage of the Horizon thereat upwards of 110 degrees ’ . |
| 18 | The ruling Liberal Party ( which held 24 seats ) and its supporters were expected to face a rival coalition comprising the left-wing former guerrillas of the April 19 Movement ( M-19 , 19 seats ) , the conservative National Salvation Movement ( 11 seats ) , and the Embera and Guambino Indian leaders Francisco Rojas and Lorenzo Muelas , from the north-west jungle region and the southern mountain region respectively . |
| 19 | At 8am each morning , the 80-odd contestants were expected to run a full marathon while it was still cool enough . |
| 20 | Nevertheless , increased oil revenues , due to production increases and the sharp rise in prices , were expected to produce a 3 per cent growth in GDP . |
| 21 | Just four days after completing a 30-hour journey from Edinburgh to Darwin they were expected to overcome a nine-hour time difference and temperatures in the 90 's to beat a Northern Territories Invitation XV . |
| 22 | If you were to try to see a top specimen of every breed at Crufts you would have to attend on all four days and walk a good couple of miles ! |
| 23 | His own approaches , however , brought only the admission from Washington that the talks were designed to reach a better understanding of the respective positions of the two countries . |
| 24 | The theology of liberation first developed in the 1960s as a Christian Socialist philosophy which holds that it is the duty of the Catholic Church to work for social and economic reforms , particularly in the Third World , and to adopt the cause of the oppressed , These positions were approved at a meeting of Latin American bishops in Medellin , Columbia , in 1968 and represented a watershed for the church in Latin America , The Medellin documents openly denounced the poverty and brutality of the relations of production in Latin America : withdrawing support from the classes in power the bishops called , most significantly , for agrarian reforms , The documents proposed programmes , based on the method of Paulo Freire 's " education for liberation " , which were designed to promote a new sense of community action for change among the poor . |
| 25 | At the risk of oversimplifying , the new style of labour relations were designed to overcome a high turnover of skilled workers , intense industrial conflict and a lack of motivation and commitment that was said to be the cause of Japan 's reputation as a producer of shoddy goods . |
| 26 | Primers were designed to amplify a 305 base pair product as INS 1 : 5' CGTGAGGGCATCGAGGTGGC 3' and INS 2 : 5' GCGTAGGCGTCGGTGACAAA 3' . |
| 27 | Some of these experiments were designed to solve a specific medical problem . |
| 28 | A number of environmental organisations were approached to do a reciprocal mailing with branches or HQ . |
| 29 | A number of environmental organisations were approached to do a reciprocal mailing with branches or HQ . |
| 30 | Before the stonework was repointed , new light fittings were installed to give a subdued , indirect light in the nave , with a slightly more intense light in the apse , focusing on the table . |