Example sentences of "[vb pp] [verb] a [num] [noun] " in BNC.
Next pageNo | Sentence |
---|---|
1 | Based on the Teesside Development Corporation 's ‘ renaissance ’ project along the river banks and old docklands , the museum is expected to attract a million visitors a year from its opening in 1995 . |
2 | Primers were designed to amplify a 305 base pair product as INS 1 : 5' CGTGAGGGCATCGAGGTGGC 3' and INS 2 : 5' GCGTAGGCGTCGGTGACAAA 3' . |
3 | Concorde was booked to fly a dozen executives on a two week fact finding tour of America . |
4 | Such procedures are right for generating the phenomenon in Wagner 's associative form — a series of widely spaced exposure trials will promote the formation of a context-stimulus association ; and the after-effects of presentation of the target stimulus could not be expected to survive a 24-h retention interval . |
5 | A manufacturing company would be expected to maintain a 1:1 ratio to be credit worthy . |
6 | WaveLAN uses low power — 100mW — 2.4GHz spread spectrum technology and is claimed to have a 600 foot operating radius in open plan offices , with a 2Mbps data throughput . |
7 | He had accepted so much work that he was committed to supply a hundred dancers for the pantomime season alone . |
8 | It was essentially a fact-finding and largely descriptive exercise designed to produce a 20,000 word report which would be widely distributed in Norfolk and stimulate a debate in the Church as to its responsibilities in this domain . |
9 | FORMER Notts pace bowler Kevin Cooper is expected to sign a one year contract with Gloucestershire . |
10 | Unfortunately , this needs 2 command lines and must be done using a CLI command file . |
11 | These findings are consistent with our early experience , when attempts were made to isolate a 10 cm segment of oesophagus between two occluding balloons in six subjects . |
12 | From the 5' region of IS902 , primers P102 ( 5'-CTGATTGAGATCTGACGC-3' ) and P103 ( 5'-TTAGCAATCCGGCCGCCCT-3' ) were selected to amplify a 252 bp fragment ( nucleotides 132–383 ) , unique to IS902 . |
13 | In fact , this decision was less revolutionary than it appeared : Bush has brought the deadline forward from 2000 , as laid down under the Montreal Protocol , to 1995 , but the EC had already decided to adopt a 1997 deadline and the US had been lagging behind world opinion . |
14 | Details were sketchy as NME went to press , but it is understood that an application to Northaven District Council in the west country has been made to host a 100,000 capacity open air event , running over June 21 , 22 and 23 — the weekend Glastonbury traditionally takes place . |
15 | This company had decided to produce a 3/4 wheel car and a small van . |
16 | After washing in tap water and then Tris buffer ( pH 7.3 ) for 5 minutes ( ×3 ) , sections were stained using a three stage peroxidase procedure in which Ki-67 monoclonal antibody ( 1:50 in Tris buffer ) , biotinylated rabbit anti-mouse ( 1:300 in Tris buffer ) , and avidin-biotin complex ( Dakopatts ) were applied . |
17 | Transendoscopic Doppler ultrasound was performed using a 20 MHz microvascular Doppler device ( MF 20 , Eden Medical Electronics , Germany ) . |
18 | First , the 1981 Census of Population was not made available for grid squares and , second , our estimates were produced using a 1984 satellite image and 1981 Census ward data . |
19 | Basis has agreed to sell a half-million dollars worth of the C++ SoftBench 3.0 and SoftBench 3.0 products on Sparc machines . |
20 | Christian Education Movement — A grant of £16,693 was approved to create a 3 year part-time post which will develop curriculum material and teaching strategies in RE and PSE in schools in the principles and issues of world development . |
21 | The East Leyton Singers raised £210 at Christmas through carol singing , £120 was used to buy a Tens machine for pain relief for the Gainford doctor 's practice , and £90 will be given to Dr Margaret Mowbray to give to a person in need . |
22 | They have been shown to express a 72 kDa type IV collagenase/gelatinase with activity against the normal liver matrix , tissue inhibitor of metalloproteinase-1 ( TIMP-1 ) , a potent inhibitor of the matrix degrading metalloproteinases and they also express interstitial collagenase , an enzyme with degradative activity against the excess interstitial collagens that characterise fibrosis . |
23 | She was told to expect a five hour delay … in the event she endured a nine hour wait … |
24 | I said if I 've got to do a dozen sausage rolls for one I 'd better do them for the others . |
25 | A hung parlian A hung parliament To get into parliament in the house of commons you 've got to have a thirty percent majority . |
26 | You 've got to have a thirty percent I 'm not on about seats . |
27 | You 've got to have a thirty percent majority . |
28 | You 've got to have a thirty percent majority . |
29 | this is the story of my life now in the bathroom I have had , I have had to pay a hundred pounds to Mr Butcher the plumber to put in a new shower thing because that was cheap and rough and eventually wore out should never have been put in . |
30 | St Bernards had placed a fee on this transfer should he go to a Football League club so Palace had to settle with them and with Kettering , but his eminent place in the club 's history assures us that if Palace had had to pay a dozen clubs , it would have been money well spent . |