Example sentences of "[v-ing] [art] [noun pl] [noun] and " in BNC.
Next pageNo | Sentence |
---|---|
1 | Kim Il Sung may have feared rumblings of discontent at the money spent on building the sports arenas and on entertaining delegates to the Festival . |
2 | Schistosome DNA prepared from male ( b , d and f ) and female ( a , c and e ) cercariae shed from snails infected from single miracidia , and thus essentially cloned , was amplified using the primers 5'-GTGAAATTCTTCCTTCACAC and 5'-GACATTCAACTCAATGTTCG for the amplification of the repetitive female specific sequence W1 ( 3 ) . |
3 | The LSA-1 gene was amplified for 35 cycles from nt , 5,372 to nt 5,701 ( ref. 25 ) using the primers GTGCTGAATATGACGATTCA and CCTTTTCCTTATTAACCTGC , in a buffer with 1mM MgCl and 10% DMSO , with annealing at 55°C . |
4 | The solvent flattened electron density map ( Fig. 1 b and 1e ) was skeletonized using the program BONES , and the skeletonized map was used with the density to trace the main chain of both monomers in the asymmetric unit using the program O. A monomer mask was generated at this point , and non-crystallographic symmetry averaging using the programs A and O was used to improve the side chain density in parts of the molecule . |
5 | People are using the words Oscar and Pauline Collins in the same sentence . |
6 | It is appropriate here to start with the main equation in the form ( 10.62 ) using the variables t and z defined by ( 10.60 ) , and then transforming it by putting ( 10.72 ) where the parameters v and η are not necessarily real . |
7 | FIR filter design using the Parks McClellan and Window design methods , Differentiator and Hilbert transform design , IIR filters based on bilinear transform method , Display transfer functions , impulse response and pole/zero positions , Design filter directly from transfer function plane by specifying frequency cut-offs and attenuation levels , Quantise coefficient to a given word size , and Code generation for specified DSP device . |
8 | Second , how to explain other ( earlier ) classical evidence which seems imprecise in using the terms fideicommissum and legatum ? |
9 | An active secondary market in which shareholders who have access to information about the company and are able to deal freely , will lead to share prices accurately reflecting the companies prospects and in turn the accurate pricing of new issues . |
10 | Completion within budget depends on a combination of understanding the projects objectives and decision- making process |
11 | The poet who would go on in ‘ East Coker ’ to write of poetry as ‘ a raid on the inarticulate ’ now pulls back from his earlier position in his wish ‘ to avoid employing the terms Romanticism and Classicism ’ , and concludes that ‘ we are still in the Arnold period ’ . |
12 | But if phonemic competitors are included , some means of resolving the phonemes identity and filtering out improbable words must be applied as quickly as possible to stop the proliferation of word strings . |
13 | In fact the ack-ack unit , who thought , or hoped , they might be protecting the princesses Elizabeth and Margaret , in residence at Windsor Castle , almost missed the fun entirely , having been told the raid would be at 2 a.m . |
14 | Offering it to armies of administrative assistants doing non-commercial jobs in the great clerical factories underpinning the benefits system and in a nation-wide network of local offices , is another matter . |
15 | You quickly get past the point of worrying that there are no guitars here , Phil Ramone and the orchestra do a superb job of keeping the arrangements crisp and fresh , and the strings never overwhelm the singer , even when she is at her most whispering , as in the Marilyn vehicle ‘ I Want To Be Loved By You ’ and amidst the tragic melancholy of ‘ Gloomy Sunday ’ . |
16 | He does this by systematically replacing the terms man and woman with white and black . |
17 | The turmoil in foreign exchange markets of the late 1960s was perceived by the EC member countries as placing in jeopardy the successes achieved in establishing a customs union and the common agricultural policy . |
18 | We work with these ‘ linked ’ organisations on all aspects of archiving but especially with respect to developing an acquisitions policy and promoting the use of the specialist archive ; |
19 | But that does n't mean to say that what Danny said was very valuable , and as you said Adrian , the four , the four parties , the receiver , the thirty party receiver , the people who are paying the bills buyer and us are very happy in many cases with using carriage forward in a positive way not just for returns |
20 | It may be better just to concentrate on keeping straight , holding the wings level and getting the tail up as soon as possible , to reduce the wing 's angle of attack and so improve the aileron power . |
21 | I see boys calling the girls fat and it makes my hair stand on end ! |
22 | Praxsys reportedly used Microsoft manuals in reconstructing the Windows API and played detective to find its undocumented systems calls . |
23 | ‘ I 'm also wearing a sports shirt and trainers , like you . |
24 | WIRRAL Magistrates bailed Andrew Ashman 24 , of Waterpark Close in Prenton for 4 weeks for reports after he admitted entering the locker room at Prenton golf club and stealing a sports bag and contents in May . |
25 | Wyld Stalyns on the front cover , cast of EastEnders reviewing the singles , Fred from The Family Cat doing Fred Fact , Sonia compiling the crossword , Postman Plod ( he 's a miserable bastard ) doing the letters page and the editor from Press Gang as editor |
26 | But he was coming for doing the borders Peebles and Selkirk down that and Roxburgh . |
27 | It 's not really part of Foulness — if you look closely you can see that it 's cut off from Foulness proper by a sort of strait linking the rivers Roach and Crouch . |
28 | Erm oh well I 'll er the other thing I was thinking of is that er we could be looking er towards beginning , you know even now , to doing a trips network and things like that . |
29 | Try recording a blues progression and use the blues scale for improvising . |
30 | The report looks at the reasons for having a complaints procedure and discusses the principles of good practice for complaints and appeals procedures . |