Example sentences of "[adv] [adv] [to-vb] [art] [adj] " in BNC.
Next page| No | Sentence |
|---|---|
| 1 | ( b ) those details and examples that seem most successfully to illustrate the main points . |
| 2 | Take the crack through these then traverse delicately leftwards to reach a good ledge . |
| 3 | For a convincing construction of a normal form it is not enough merely to list a few types of equivalence that can arise and show how to deal with them . |
| 4 | ‘ You 've taken long enough to do a simple errand , I must say . |
| 5 | He unclasped them just long enough to push a small packet across the desk towards Ruth . |
| 6 | He remained just long enough to save a substantial sum by the standards of Irish wealth and then came home with his newly acquired capital . |
| 7 | Rosé Champagne is achieved either by blending or by allowing the black grape skins ( Pinot Noir and Pinot Meunier ) to stay in contact with the juice long enough to impart a pale rose colour . |
| 8 | It was thought that if the balls of soft paste were boiled , long enough to toughen the outer surface , but not for too long so that the inner remained soft , there would still be plenty of flavour left in the bait to serve its purpose , and sufficient toughness to make it extremely difficult for a smaller fish to take the bait in smaller portions . |
| 9 | For most people it seems that it is necessary to stay long enough to enjoy the bad weather as well as the good , to gain a true appreciation of the countryside . |
| 10 | Benjamin had just lived long enough to see the first of his children married : Ella Frances May Titford 's wedding had taken place on 26 August 1905 , in that very church in which her father was to collapse eight days later . |
| 11 | He had stayed long enough to see the first stage of the counter-inflation policy accepted and the clash and confrontation of two years earlier replaced by a new partnership . |
| 12 | ‘ Long enough to form an educated opinion , min skat — ’ |
| 13 | Some stances may be held for only a fraction of a second , just long enough to provide the correct arrangement of balance , position and technique availability . |
| 14 | She saw Defries , and paused long enough to make a curious gesture : a closed fist , and the thumb sticking upwards . |
| 15 | Khrushchev appeared in Paris long enough to make an angry denunciation of American policy and then withdrew , leaving an embarrassed Eisenhower to return home , empty-handed . |
| 16 | It looked and sounded great but rarely ran long enough to satisfy a wide variety of drivers . |
| 17 | Helen had been with Culley long enough to recognize a red light . |
| 18 | Despite the urgency of the summons , he had been kept waiting in Stevenson 's outer office long enough to read the early edition of the Evening Standard . |
| 19 | Others , however , probably burrowed underground , surviving long enough to become the first true mammals . |
| 20 | Formal research into the headaches began in 1970 and , until now , no-one has followed up patients for long enough to determine the natural course of the condition . |
| 21 | Installed in the power supply to the immersion heater , a push-button sets an electronic timer long enough to heat the average household hot water cylinder . |
| 22 | Forward cyclic is applied only long enough to produce a slight nose down attitude in the model . |
| 23 | Based largely on Michels 's study of trade union organizations , the model supposes that once any radical organization has grown to the size where it needs to delegate responsibility to professional organizers , and once it has been in existence long enough to produce a complex bureaucracy , then the original radical thrust is lost as the professionals redirect the organization to serve their own ends . |
| 24 | Supporting her with his right arm , his left hand strayed from her breasts to her thigh , and from there slowly completed the journey to the mouth of the Cave of Sweet Mysteries , lingering long enough to find the little temple of Min and arouse him as she began to gasp for breath , her tongue making passionate sallies into his ear . |
| 25 | Pausing just long enough to sweep the old man 's triumphant face with an antagonistic look , Beth turned from them both and went , head high , out of the room and into the hallway , where the late March sunshine found its way through the tall arched windows , and where the air seemed relatively fresh compared to the musty damp smell of the old man 's den . |
| 26 | For women whose kitchens have been their own , it seems to come naturally enough to share the domestic space in the refuge and at least here they have a room of their own — possibly for the first time in their lives . |
| 27 | He thinks that expanding opportunities , especially in manufacturing , meant that in some districts the earnings of women and children were able to double family income — perhaps enough to add the extra 150,000 households Eversley considered were needed to explain the leap in home demand between 1750 and 1780 . |
| 28 | Except for marine products , the few goods that polar regions yield are seldom valued highly enough to offset the high costs and risks of exploiting them . |
| 29 | Francis believes he could become Alan Shearer 's partner in the England side , and rated him highly enough to agree a new , four-year contract in the summer worth £4,000 a week . |
| 30 | The effect of the GC step in the context of GGGCCC motif seems to be about as large as that of AA/TT , i.e. it is apparently enough to cancel the macroscopic curvature of helically phased A-tracts.The origin of the macroscopic curvature for the ( AGGGCCCTAGAGGGGCCCTAG ) n DNA can be explained by an overall roll angle difference between the GGGCCC and CTAGAG sequence elements , which will add up if the two motifs are separated by a distance close to the helical repeat length . |