Example sentences of "[adv] [to-vb] the [adj] [noun sg] " in BNC.
Next pageNo | Sentence |
---|---|
1 | It is with sincere people such as these in mind that this leaflet has been written — not to ride roughshod over a sincerely held belief but rather to confirm the absolute necessity of finding Purgatory , but not a Purgatory that is arrived at after death which is the popular view , but rather a Purgatory that is found before death which is the proper view according to God 's guide , the Holy Bible . |
2 | The bulk of capital continued , however , to be supplied by the landed interest whose resources and local initiatives did most to provide the improved road network . |
3 | Yanto 's head throbbed abominably as he cycled slowly to work the following morning , but at least it was Saturday , he told himself thankfully . |
4 | Such evidence is given by phrases including ‘ I saw women with prams obstructed by the offending vehicle parking across a pavement ’ ; ‘ several motor cars had to negotiate carefully and slowly to pass the offending vehicle ’ etc . |
5 | Looking round for somewhere to hide the wrecked toy she climbed on to a chair and put the doll on top of the nursery cupboard . |
6 | They are simple to install , for all that is required is that they be level from side to side , and with the lip protruding sufficiently to enable the full body of water to be emptied into the pool rather than on to the surrounding ground ( Fig. 9 ) . |
7 | Since there is no net escape of RNA polymerase past the identifiable platination site , the most likely explanation of this effect is that the intercalator perturbs the geometry of the coordination complex sufficiently to enable the catalytic site of the RNA polymerase to move slowly an additional one or two bp along the DNA . |
8 | Michael made a good recovery , and was well enough to enjoy the international conference given at the time of his retirement . |
9 | ‘ We were lucky enough to enjoy the fine weather and gentle hills while raising money for a good cause , ’ he added . |
10 | For most people it seems that it is necessary to stay long enough to enjoy the bad weather as well as the good , to gain a true appreciation of the countryside . |
11 | Especially to see the wide lady . |
12 | Coming back , as always , to the Jurassic , one has only to compare the 30 ammonite zones represented in one foot of sediment in Sicily with the 15 000 feet representing a single zone in Oregon , to realise how startlingly different rates of deposition must have been in different places . |
13 | All you have to do is to understand the right habit or growing style of the crops and time your sowings and plantings with that in mind , ensuring that soil fertility levels are kept high enough to support the extra output . |
14 | He had stayed long enough to see the first stage of the counter-inflation policy accepted and the clash and confrontation of two years earlier replaced by a new partnership . |
15 | He welcomed the European Commission on Human Rights ' ruling that the case of the three IRA members killed by the SAS in Gibraltar was good enough to go the European Court . |
16 | ‘ It was Mrs Hardcastle — Alison has a nasty attack of flu , and she wo n't be fit enough to wear the chief bridesmaid 's dress on Saturday . ’ |
17 | Those ladies slim and brave enough to wear the high fashion were ethereal in gauzy dresses that clung to their bodies as they moved . |
18 | The body is solid alder , arched gently at the front and back and tapering to a width which is just wide enough to accommodate the Switchcraft-type output jack socket on the lower rim . |
19 | Thus the extreme subjectivism of , for example , the novels of Virginia Woolf , belongs within the same formation as the economic interventionism of Keynes , who wanted not only to preserve the economic system by rationalizing it but to do this so that , within that achieved stability , the real processes of civilized life could be extended , undisturbed . |
20 | On Nov. 13 and 17 respectively the court ruled that Stoph , who had not been well enough to attend the previous day and had heart problems , and Mielke were too ill stand trial . |
21 | The first stages are fitted with input offset adjustments just large enough to cancel the largest field likely to be encountered , namely the total inclined component in the middle latitudes . |
22 | The effect of the GC step in the context of GGGCCC motif seems to be about as large as that of AA/TT , i.e. it is apparently enough to cancel the macroscopic curvature of helically phased A-tracts.The origin of the macroscopic curvature for the ( AGGGCCCTAGAGGGGCCCTAG ) n DNA can be explained by an overall roll angle difference between the GGGCCC and CTAGAG sequence elements , which will add up if the two motifs are separated by a distance close to the helical repeat length . |
23 | Ceauşescu 's arrogance in presuming not only to treat the Soviet General-Secretary as a person on a par with himself , but also one without the necessary experience to speak with the full authority of a veteran revolutionary like himself undoubtedly aroused a mixture of irritation and amused contempt in Gorbachev . |
24 | Ford defended his action , pointing out that a protracted trial of the former President would serve only to continue the long agony of Watergate , and distract the United States and its people from more urgent matters . |
25 | ‘ Rational ’ — a word that can take on various meanings and get one into all sorts of trouble — is here being used to describe those models that ignore organizational behaviour and suggest that the decision-maker has near-perfect knowledge , power and insight , needing merely to conduct the necessary analysis and implement it . |
26 | It certainly continues beyond 10 bars but this is deep enough to include the main cloud layers that are likely to exist . |
27 | The flirting remains , perhaps to assure the sophisticated reader that Modernism has been absorbed and transcended , not merely ignored or forgotten . |
28 | During the hunts , females are left on their own lot , and so to enable the whole group to re-form after the hunt , the two sexes have to co-ordinate their separate movements , staying within calling distance of each other . |
29 | Turning her back on Maman 's room , and Dada 's dressing room , she crossed the pavilion-like hallway — useful only to light the double staircase through its long floor-to-ceiling window . |
30 | Worst for Mr Clinton , he might jilt California only to see the Supreme Court decide for state over federal rights , thus losing face for nothing . |