Example sentences of "[adv] [verb] [n mass] [noun sg] [prep] " in BNC.
Next page| No | Sentence |
|---|---|
| 1 | FINANCIERS are pushing for Alan Bond 's highly geared media group to be taken over by Australia 's richest man , Mr Kerry Packer , and some leading institutions . |
| 2 | People in my trade are supposed to be able to help , but I 've only been able to come up with the old platitude : ‘ Do n't buy a £500 car from a dealer because you 'll only get £100 worth of vehicle — the rest will be profit . ’ |
| 3 | This time , however , the bank could only afford 55% cover against its loans while the other banks were setting aside 70% or even 80% . |
| 4 | Not only had £250,000 worth of equipment fallen off the back of a submarine , but the torpedo firing system and the periscope were out of commission as well ! |
| 5 | His rare combination of mechanical and drawing skills enabled him to find work quickly , soon becoming works manager at Bramahs , and by 1815 he was chief draughtsman at Maudslay , Sons & Field . |
| 6 | I just hope people sort of sit up and take notice of it . |
| 7 | He said the college had already secured £20,000 worth of grants from European Community funds with a further £20,000 in the pipeline . |
| 8 | I expect Sinbad feels that as I 'm in the last few months of my final year , she 'd better pack me with as much experience as possible before I get whisked away to act staff nurse in some ward . |
| 9 | But the new lift sector in the UK still has £400m worth of work a year up for grabs , from the smallest nursing home service lift to multi-storey hotel contracts . |
| 10 | You can still buy £10 worth of Premium Bonds , but the minimum is £25 for the issue E Children 's Bonds which return 7.85 per cent gross a year . |
| 11 | Spence later caused £681 worth of damage when he jumped up and down on an Escort . |
| 12 | They also ordered £25,000 surety to be seized . |
| 13 | The students also questioned Yuan Mu about the fate of Zhao Ziyang and the selection of Jiang Zemin as Zhao 's successor but received no answers . |
| 14 | Do you also require a. digest of them ? ’ |
| 15 | When you book a selected golf holiday in the 1991 Solgolf brochure ( one of Britain 's leading golf holiday companies ) as a Golf Plus club member you will automatically receive £25 discount on your holiday invoice . |
| 16 | The first prizewinner will also receive £250 worth of vouchers to spend at a range of top high-street stores ; the 12 second prizewinners get £80 worth of vouchers . |
| 17 | The winner will also receive £1,000 worth of Sainsbury 's wine . |
| 18 | As they are a clearly established data subset in the Census of Production , their collective performance can therefore be compared directly with that of UK manufacturing companies in the UK . |
| 19 | However , it also makes data retrieval from different parts of the disc slow compared , say , to random access from a magnetic disc . |
| 20 | It also improves data transfer to 10M-bytes a second , double the previous SCSI-1 drives . |
| 21 | ( It may also increase staff unrest by leading prison officers to feel that their ‘ authority ’ is further threatened . ) |
| 22 | As Steve Bevan , editor of Sales Promotion magazine says : ‘ Companies are now using sales promotion on a more strategic basis , ensuring it ties in with an overall brand strategy . |
| 23 | The company now offers data compression for TCP/IP , IPX , XNS , Vines/IP , AppleTalk , DECnet and Open Systems Interconnection as well as bridging . |
| 24 | The effect of the GC step in the context of GGGCCC motif seems to be about as large as that of AA/TT , i.e. it is apparently enough to cancel the macroscopic curvature of helically phased A-tracts.The origin of the macroscopic curvature for the ( AGGGCCCTAGAGGGGCCCTAG ) n DNA can be explained by an overall roll angle difference between the GGGCCC and CTAGAG sequence elements , which will add up if the two motifs are separated by a distance close to the helical repeat length . |
| 25 | Higher-end models of the 80486 DeskPro/M now have 8Mb standard at from $2,400 . |
| 26 | ( i ) Fix the embryos or blastomeres for 15–30 min at room temperature in freshly prepared 3% glutaraldehyde in 0.1 M sodium cacodylate ( pH 7.3 ) . |
| 27 | Over half of all patients developed a clinically import nt complication in the first 100 operations ( 52% ) ; this figure has now fallen to 25% in the last 68 operations . |
| 28 | Convoy Aid Romania was due to leave Middlesbrough for Eastern Europe early today taking £10,000 worth of powdered milk to feed starving orphans . |
| 29 | He might even get media coverage beyond the protected , precious and self-indulgent ‘ God slots ’ . |
| 30 | Rosa was there drinking fruit juice with Fritz Kott and a few other pupils from the Egon Schultz School who greeted her with the same , unanimous question : ‘ What happened ? ’ |