Example sentences of "[unc] [vb -s] a [adj] [noun] " in BNC.
Next page| No | Sentence |
|---|---|
| 1 | The OU offers an enormous range of subjects at many different levels . |
| 2 | The Z88 has a uniform device independent I/0 system . |
| 3 | Performance-wise the 33MHz 486SX has a slight benefit over the 25MHz version in processor-intensive tasks . |
| 4 | Most models use plastic lugs for fixing but the CB30 has a single screw fixing . |
| 5 | For a small drill the 6012HDW has a high specification . |
| 6 | Section 17(1) imposes a general welfare duty on local authorities and obliges them to provide services for a particular group of children identified as children in need . |
| 7 | In a previous paper we reported that the repeating sequence 5'AGGGCCCTAGAGGGGCCCTAG3' displays an anomalous gel mobility , characteristic for curved DNA , even in the absence of AnTm tracts ( 4 ) . |
| 8 | Thus a regression of membership on Β and wages should find that Β has an insignificant effect . |
| 9 | The crystal structure presented here suggests that GH5 has a primary mode of binding to DNA based on the similarity with CAP , and the presence of a secondary site that could bind to another duplex of DNA . |
| 10 | This indicates that region 1–110 of RAP30 contains a minimum sequence essential for interacting with RAP74 in vivo . |
| 11 | Thus , it seems unlikely that KG53 recognises a toxic amino acid sequence within A-gliadin . |
| 12 | Thus , RAP30 forms a large complex with RAP74 and RNA polymerase II at the closely located sequences , 1–110 and 111–152 , respectively , although these sequences might overlap . |
| 13 | The implied terms in s12 of the SGA 1979 , concerned with the seller 's right to sell the goods , can never be excluded or restricted , although s12 implies a reduced obligation in certain cases . |
| 14 | Article 11(2) carries a similar proviso . |
| 15 | Although clearly a necessary factor , it is unclear whether a rise in postsynaptic Ca 2+ provides a sufficient trigger for the induction of LTP . |
| 16 | Section 50C(2) provides a specific example of when this may be necessary , that is , where it is for the purpose of error correction . |
| 17 | But this kind of assertive coup de main carries a huge risk . |
| 18 | It may be an engine from the old school — a single overhead camshaft per bank operates ‘ only ’ two valves per cylinder — but the Renault V6 produces a respectable 170bhp at 5500rpm — about the same as the Volvo 850 2.5 GLT 's 20-valve five and the Honda-derived Rover 2.7-litre V6 . |
| 19 | My Lords , I do n't think co-option is satisfactory under these circumstances er I think my erm th the Noble Lord has a good route er has a good number but a bad route and that my Noble Friend is in the position to propose a good route er if he will get the right number . |
| 20 | Patterning facilities are versatile — the KH864 has a special feature for automatically knitting single motifs or blocks of pattern by using motif cams . |
| 21 | Somebody s somebody does a er develops a nervous twitch and stuff . |
| 22 | Removing neuron X2 has a similar effect on response to training pattern F'3 . |
| 23 | Whilst BBCBASIC(Z80) has a large number of predefined functions ( INT and LEN for example ) it is very useful to be able to define your own to do something special . |
| 24 | RETURN and FN/PROC operations , BBCBASIC(Z80) uses a single control stack ( the processor 's hardware stack ) for all looping and nesting operations . |
| 25 | For example , a whole range of plain and purl patterns , moss stitch and rib formations are possible with the KG89 Garter Carriage — The KH864 features a built-in rail to accommodate this popular attachment . |
| 26 | Stoichiometry of the purified endonuclease and the ratio of subunits produced in minicells. 2a shows a SDS-PAGE analysis of the proteins produced in minicells from the following plasmids : Lane 1 , pBR322 ; Lane 2 , pVMC3 ; Lane 3 , pVM39 . |
| 27 | Figure 2a shows a C-banded MI from the mouse translocation T ( 14 ; 15 ) 6 Ca . |
| 28 | Ex.2g shows a similar case where Mozart combines the spelled-out ‘ staccato ’ with clear strokes . |
| 29 | Section 3(2) protects an innocent purchaser from an accusation of theft when , having bought in good faith from someone with a defective title , he later treats the property as his own . |
| 30 | That way the fi the surpluses left behind would be less , but the person transferring and we 're going to see more and more of this today er takes a fair amount of money with him . |