Example sentences of "[verb] [art] [noun pl] [noun] [conj] " in BNC.
Next page| No | Sentence |
|---|---|
| 1 | That was more a reflection on Dead Certain 's ring rustiness than her stamina and Asmussen said : ‘ She 's a very good filly and I 'm sure she 'll stay the Guineas mile because she 's got such a lovely relaxed temperament . ’ |
| 2 | Kim Il Sung may have feared rumblings of discontent at the money spent on building the sports arenas and on entertaining delegates to the Festival . |
| 3 | Power , a New Zealander , plays the blues harp and the chromatic harmonica . |
| 4 | Schistosome DNA prepared from male ( b , d and f ) and female ( a , c and e ) cercariae shed from snails infected from single miracidia , and thus essentially cloned , was amplified using the primers 5'-GTGAAATTCTTCCTTCACAC and 5'-GACATTCAACTCAATGTTCG for the amplification of the repetitive female specific sequence W1 ( 3 ) . |
| 5 | The LSA-1 gene was amplified for 35 cycles from nt , 5,372 to nt 5,701 ( ref. 25 ) using the primers GTGCTGAATATGACGATTCA and CCTTTTCCTTATTAACCTGC , in a buffer with 1mM MgCl and 10% DMSO , with annealing at 55°C . |
| 6 | The solvent flattened electron density map ( Fig. 1 b and 1e ) was skeletonized using the program BONES , and the skeletonized map was used with the density to trace the main chain of both monomers in the asymmetric unit using the program O. A monomer mask was generated at this point , and non-crystallographic symmetry averaging using the programs A and O was used to improve the side chain density in parts of the molecule . |
| 7 | People are using the words Oscar and Pauline Collins in the same sentence . |
| 8 | It is appropriate here to start with the main equation in the form ( 10.62 ) using the variables t and z defined by ( 10.60 ) , and then transforming it by putting ( 10.72 ) where the parameters v and η are not necessarily real . |
| 9 | FIR filter design using the Parks McClellan and Window design methods , Differentiator and Hilbert transform design , IIR filters based on bilinear transform method , Display transfer functions , impulse response and pole/zero positions , Design filter directly from transfer function plane by specifying frequency cut-offs and attenuation levels , Quantise coefficient to a given word size , and Code generation for specified DSP device . |
| 10 | Second , how to explain other ( earlier ) classical evidence which seems imprecise in using the terms fideicommissum and legatum ? |
| 11 | As a preliminary to their blockbuster , Castle Houses had arranged the awards dinner and subsidised the tickets so that more or less everyone could afford them . |
| 12 | We are given the matrices C and B , both symmetric an pos. def . |
| 13 | Similarly and are known as the tensile and shear compliances and given the symbols D and J respectively . |
| 14 | Do we aid the overstretched budget — deny the children books and equipment in order to engage outsiders to do it and in so doing lose the rapport so carefully built with our staff ? |
| 15 | Yeah , the sort of thing Lucy and I were talking about earlier is , it was just before I went on holiday so my memory is kind of hazy , it 's one where I was going to see the Arts Council and see if they were interested in the idea if they work |
| 16 | This is a very serious matter as , whether rightly or wrongly , it is the number of heads which impresses the Sports Council when issuing grant . |
| 17 | For most men the interior light of the mind is dark as in a black and white picture but we can make the dawns rise and colours come as in a coloured picture . |
| 18 | Take the High Road , which has been running for 13 years , does n't make the ratings tables because it is not slotted in a peak viewing time across the country . |
| 19 | Aw , c'm on , it was just like that in Australia not long ago : one of the wire services reports in a condescending way that under local law , the National Institute of Industrial Property of Brazil recognises only the principle of priority in brand names , so that companies like IBM Corp , Xerox Corp and Sony Corp have had to ‘ buy back ’ their names before they could do business under them in Brazil ; the US is pressing Brazil to change the law to protect internationally recognised brand names — but it is not so long ago that , legend has it , an enterprising travelling Australian spotted that car hire was becoming big business , so when he got home , he registered the names Hertz and Avis , sold the Hertz name back to the company when it wanted to set up in Australia — and then used the cash he got from Hertz to set up the Avis concession in Australia . |
| 20 | Visitors often pop into reception , one caller recently brought in a vole wrapped up in paper and asked the girls advice as to what to do with it . |
| 21 | Chris Stanley has also joined the Contracts Division as Representative for East London , Essex , Sussex and Kent . |
| 22 | ( 13 ) If the cash for the bid is to be raised by a rights issue of the bidder ( cash placings to selected shareholders or third parties are strongly resisted by the IPCs without shareholders being offered pre-emption entitlements , particularly if the issue is at a significant discount ) , then it may be necessary to increase its authorised share capital and directors ' authority to implement the rights issue and , if the issue will not comply with the strict statutory requirements of CA 1985 , s89 , to pass a special resolution to disapply that section . |
| 23 | An active secondary market in which shareholders who have access to information about the company and are able to deal freely , will lead to share prices accurately reflecting the companies prospects and in turn the accurate pricing of new issues . |
| 24 | The Board has decided to change the rules to require duty solicitors to attend the police station where a suspect is to be questioned about an arrestable offence , when an identity parade is to be held , or the suspect complains of serious maltreatment by the police ; unless the solicitor can show exceptional circumstances justifying non-attendance . |
| 25 | Raise the elbows head and shoulders towards the knees and hold up for 5 counts . |
| 26 | Lying as shown raise the elbows head and shoulders , bringing your chin towards your chest . |
| 27 | Lying as shown , raise the elbows head and shoulders towards the knees and hold up for 5 counts . |
| 28 | It is therefore necessary to include the personnel manager and a trade union representative in the systems planning team . |
| 29 | Failure to register renders the restrictions void and unenforceable . |
| 30 | That now looks improbable , first of all because the new , bloated Heritage department turns the Arts Council and its peers into smaller fish in a bigger pond that stretches from broadcasting on one side to museums on the other . |