Example sentences of "[verb] [verb] a [num] [noun] " in BNC.
Next page| No | Sentence |
|---|---|
| 1 | That is , if you do n't want to risk a 10 ft sunflower towering out of your windowbox . |
| 2 | raise say a hundred pound or seventy five and then that can go towards payment er the payment for someone to patrol the car park for the plays . |
| 3 | It is no use telling a man who has received a thousand pounds a year in giro cheques that he has the means to better himself . |
| 4 | Dr Proctor , already a wealthy man , has received an eight figure sum for the movie rights to his forthcoming autobiography What 's Cookin' , Doc ? , and director Kim Newman has already announced his intention to cast either Jeremy Irons or Steve Martin in the leading role . |
| 5 | Already one firm has developed a 30 W source of this type which gives a light like a 100 W light bulb . |
| 6 | As regards restoration , just as we would not dream of stripping out the original interior of the Blackfriar , by the same token we would not seek to preserve a Thirties estate pub which had long since ceased to address the needs of the community it was built to serve . |
| 7 | After it has travelled a hundred yards or so , it bivouacs . |
| 8 | The Soviet-American joint venture ‘ 21st-Century Technologies ’ has given a million roubles and a truckful of restoration materials has arrived in Moscow , courtesy of the Schirn Kunsthalle in Frankfurt . |
| 9 | Based on the Teesside Development Corporation 's ‘ renaissance ’ project along the river banks and old docklands , the museum is expected to attract a million visitors a year from its opening in 1995 . |
| 10 | It has reported a 77 p.c. increase in complaints and cited pension transfer advice as one of the biggest problem areas . |
| 11 | Motor deal : Sanderson Townend & Gilbert has let a 980 sq ft shop at 146 High Street Redcar to Motor World . |
| 12 | As part of its future direction , ADDS previewed a 3270/X software package for migrating 3270 users to NCR 's Open Cooperative Computing Architecture beginning in the first quarter of 1993 . |
| 13 | Since you can not issue CLI " dot " commands from the keyboard , you will need to write a CLI command file using PipeDream in order to redirect the printer input or output . |
| 14 | Cincinnati , Ohio-based Cincom Systems Inc has won a five year , $10m contract to supply its local area network database software , Supra Server , to the US Defense Information Systems Agency and the Defense Commercial Communications Offices . |
| 15 | Cincinnati-based Cincom Systems Inc has won a five year , $10m contract to supply its LAN database , Supra Server , to the US Defense Information Systems Agency ( DISA ) and the Defense Commercial Communications Offices . |
| 16 | But the British Government , unconvinced the fastest bikes are more dangerous , has won a five year exemption and an EC Commission promise to produce road safety evidence before Britain will come into line . |
| 17 | The owner of an eighteen foot fibre glass shark has won a six year battle to keep it on the roof of his terraced home . |
| 18 | Seeq Technology Inc , Fremont , California has won a six month extension of its $5m bank-credit agreement with Silicon Valley Bank ; the agreement expired on February 15 and now matures on September 30 . |
| 19 | One of Britain 's oldest breweries has won a two month battle against a hostile takeover bid . |
| 20 | For an investor who has selected a 1995 maturity date , BFS says the net asset value would have to fall by 5 per cent over the six years for the investment trust to be unable to pay up . |
| 21 | Mitsubishi has built a 10 kW model on its own , and may develop a 20 kW machine . |
| 22 | The closing of a station intangibly but significantly diminishes the spiritual life of a country and its people , for it brings down the curtain with devastating finality on a stage which has seen a thousand dramas , comic and tragic , played out and has mirrored the changing moods of the nation , has etched itself into the working lives of some , the emotional lives of others . |
| 23 | He has written a five page article about his illness in a Darlington medical journal and to celebrate his gradual return to good health he has started to learn the piano . |
| 24 | Football , and Oxford United manager Brian Horton has named a sixteen man squad for the vital relegation match against Peterboro tonight . |
| 25 | HP 's Larry Lytle , loaned to the Open Software Foundation back at its inception to handle recruiting , has made a 180 degree turn after a stint at Netwise as strategic relations director where he had philosophical differences with OSf : He 's now gone to Unix System Labs as director of corporate communications . |
| 26 | Primers were designed to amplify a 305 base pair product as INS 1 : 5' CGTGAGGGCATCGAGGTGGC 3' and INS 2 : 5' GCGTAGGCGTCGGTGACAAA 3' . |
| 27 | I feel very proud that Dounreay has had a two year advantage in setting up this system . ’ |
| 28 | It has opened a dozen shops with an intriguing new concept — pile it high and sell it cheap — and plans a chain of 200 . |
| 29 | A mother has offered a hundred pound reward to catch the man who shot her ten year old son in the head with an air rifle . |
| 30 | Hitachi has used a 320 watt motor in the FP 20SA , smaller than some of the competition . |