Example sentences of "[pron] [adj] at the [adj] " in BNC.
Next page| No | Sentence |
|---|---|
| 1 | If one broadens that range and spreads it more evenly , one gets away from the present situation in which those at the bottom end of the range are paying more than they need to pay because of the way the system has been constructed . |
| 2 | Recombinants ‘ oligo I ’ and ‘ oligo III ’ were produced by cloning the sequence CTGGGGAGGCGACCCCTCCCCCCTTGTCCCGACT ( nts -527 to -494 ) and its complementary or the oligonucleotide TCGCCCAGCTCAGGGCCGCGTGTGTTAGTT ( nts -479 to -450 ) and its complementary at the HindIII site of plasmid pBLcat2 ( 16 ) . |
| 3 | Similarly a grant is paid to staff who move from a rented unfurnished house or flat to a similar property at the new base or who buy a house of their own at the new location . |
| 4 | But she comes into her own at the not-bloody-likely tea party ; and by the end , she has achieved just the right blend of poignancy and pride . |
| 5 | An excursion to the top of the high alpine road of Gross Glockner will leave you breathless at the fantastic views stretching as far as the eye can see in every direction . |
| 6 | Perhaps there 's something worse at the other end of this creepy corridor . |
| 7 | I 'm watching her thirty at the big big fire wall one . |
| 8 | Oddly , it might seem , running the signal through this electronic sausage machine can make it clearer at the far end . |
| 9 | Cooper , who has lopped six to nine inches off his action , made four birdies in his last six holes , with his four at the long 16th the proverbial whisker away from a three . |
| 10 | With the preparation unquestionably right , therefore , the question was , ‘ could Forget demonstrate the big heart and the ability to play at his best at the right time ? ’ |
| 11 | THE Coleraine club and local competitors again did us proud at the European Championship meeting at Kirkistown . |
| 12 | And you 're doing your utmost at the other end straining , trying even harder and harder , the harder you try often the worse it gets . |