Example sentences of "[vb -s] [prep] the [num] " in BNC.
Next page| No | Sentence |
|---|---|
| 1 | He had first reported to Donleavy on the use of counterfeit money for DEA stings during the 1987 season , after Dany Habib had produced a sample from his desk drawer , but it was soon clear from what he observed at Eurame that this , too , had become standard operating procedure in his absence . |
| 2 | That is a pity : the price of financial distress is just about the only way in which the cost of capital for firms plausibly differs between the two rivals over the longer term . |
| 3 | The problem is both the ‘ Crunch ’ and ‘ Ultra ’ channels have the same over-processed sound , only the degree of filtration differs between the two . |
| 4 | Less than a second elapses between the two stages . |
| 5 | Charlie Swan rides Novello Allegro and also Castlina , a recent Navan winner who goes for the three miles handicap hurdle on the opening day . |
| 6 | As a starting point I want to examine some of the basic meeting points between the two communities — business and education — and some of their significant differences . |
| 7 | The break-even points between the two modes of processing can be seen clearly in Fig. 7.22 ; for numbers of records for which a sequential curve is above each straight line that represents the time required to process a record directly , direct processing is faster . |
| 8 | Motorola Inc 's design wins for the 88000 are beginning to melt away . |
| 9 | Survey formrs for the 1993 Good beer Guide will be dispatched to branches in late October . |
| 10 | goes after the nine there , but it 's now after the |
| 11 | I 've wondered whether we ought to separate but every time I bring this up , he cries and then worries about the 50 per cent of ‘ his ’ assets I 'll take with me if I do decide to go ! |
| 12 | Understanding the reasons for the decline in women 's employment after age 45 is important for community care policy , labour supply and pensions policy : older women are a major source of informal care for elderly people , yet are also a potential source of extra employees as the supply of school leavers declines during the 1990s . |
| 13 | Thirdly , the growth of computerisation within the organisation allied to the advent of newer technologies meant that the ICL 1900 series computers were being phased out and needed to be replaced with systems which would meet company needs through the 1980's . |
| 14 | Consequently , Wirral , along with a handful of other British urban communities , has during the 1980s been hit by heroin about as heavily as a community can . |
| 15 | The first meeting of the Joint Committee of Experts of Bangladesh and India agreed in New Delhi on Nov. 20 to resume negotiations on sharing river waters between the two countries [ see also p. 38913 ] . |
| 16 | Looks FOR THE 90s |
| 17 | Looks FOR THE 90s |
| 18 | Looks FOR THE 90S |
| 19 | The truth probably lies between the two extremes . |
| 20 | Where they do not coincide the coastal orientation usually lies between the two directions , being nearer to the one which is dominant . |
| 21 | The recording quality for standard 8mm is at least equal to VHS , and the comparison also holds for the two competing super-formats of Hi8 and S-VHS . |
| 22 | Looks like the 11 I predicted will be playing saturday |
| 23 | Right , that looks like the hundred , that 's the sort of left over of the hundred , so it 's just equal to seventy five over a hundred , and you |
| 24 | It looks like the seven will have to go again ! |
| 25 | The Government proposes that where a pupil has a statement of special [ educational ] needs under the 1981 Education Act , the statement should specify any National Curriculum requirements which should not apply or should be modified for that individual pupil . |
| 26 | Our results suggest that DNA binding to a sequence over the transcription initiation site is not sufficient for autoregulation as protein VT2 specifically interacts with the HSV-1 IE-3 consensus site yet evidence from transfection assays ( 17 ) and also the recombinant HSV-140 virus ( 13 ) suggests that intact 140k fails to repress this IE-3 promoter . |
| 27 | As previously described , the northern blot results were normalised by rehybridising the filters with a P 3 2 -labelled oligonucleotide ( 5'AACGATCAGAGTAGTGGTATTTCACC 3' ) that corresponds with the 28s ribosomal ribonucleic acid . |
| 28 | The key to the agreement lies in the two SNA/OSI standards points . |
| 29 | Well the answer lies in the twelve hours of negotiation that took place yesterday . |
| 30 | The real interest of the Rousset manuscript lies in the ten unknown pieces unknown , at least , to me . |