Example sentences of "[pos pn] [adj] at the " in BNC.
Next page| No | Sentence |
|---|---|
| 1 | two hundred to my right at the back , at two hundred pounds thank you , six one O at two hundred pounds . |
| 2 | I was training on my own at the time , and seemed to be constantly injured , so I was n't racing much . |
| 3 | But I remembered her asking whether I did n't go crazy on my own at The Pightle . |
| 4 | Topaz was trying to pretend that this man was n't making her weak at the knees . |
| 5 | Slowly , carefully , he pushed her away from him , flicking his lazy dark eyes over her nakedness before reaching to pull her swimsuit back up again , smoothing it over her body with a practised skill which left her weak at the knees all over again . |
| 6 | Startled , she looked up into Dane 's sea-blue eyes , and even as she tried to strengthen herself against him she felt a rush of longing so intense that it made her weak at the knees . |
| 7 | He grasped her suddenly nerveless fingers in his hand , sending her a smile with enough voltage to make her weak at the knees . |
| 8 | It 's a challenge all the more remarkable for the fact that not so long ago jetting off on holiday made her weak at the knees … |
| 9 | Equilibrium is at its lowest at the water 's surface and as pressure is exerted on the bladder its volume decreases which causes the fish to ‘ sink ’ . |
| 10 | For instance , when the selectors were working at their hardest at the English and British Match-Play Championships — Joanne was feeling and playing far below her best because of a species of salmonella food poisoning . |
| 11 | This was the first of the eight birdies Davies gathered , the best of all being her three at the 315-yard 13th hole , where she drove the green . |
| 12 | Recombinants ‘ oligo I ’ and ‘ oligo III ’ were produced by cloning the sequence CTGGGGAGGCGACCCCTCCCCCCTTGTCCCGACT ( nts -527 to -494 ) and its complementary or the oligonucleotide TCGCCCAGCTCAGGGCCGCGTGTGTTAGTT ( nts -479 to -450 ) and its complementary at the HindIII site of plasmid pBLcat2 ( 16 ) . |
| 13 | The great problem for any navigator was to know where his ship was : it was relatively easy to determine the latitude , which measures distance north or south of the equator , but it was much harder to find the longitude , or distance east or west of a fixed meridian — a line from pole to pole running through all the points at which the sun is at its highest at the same moment . |
| 14 | The letter concluded : ‘ Convinced Nazis who are really inwardly certain of our final victory do n't seem to be too plentiful even among people who have otherwise courageously held their own at the Front . |
| 15 | On the other hand , Ken has been remembered and widely admired , not only by the Oxford Movement and their successors , as the noblest , most saintly and most charitable representative of the hundreds of Anglican clergy who had grown up under Puritan rule , sustained in their faith by the memory of King Charles the Martyr , ; they had come into their own at the Restoration but had later given up comfortable benefices to live in poverty , out of a scrupulous loyalty to a monarch to whose ecclesiastical ambitions they were utterly opposed . |
| 16 | Similarly a grant is paid to staff who move from a rented unfurnished house or flat to a similar property at the new base or who buy a house of their own at the new location . |
| 17 | Yet for Labour to win on its own at the next general election would be a victory on a scale comparable with that achieved by Attlee in 1945 . |
| 18 | Its Studio Theatre has a life of its own at the forefront of creative theatre . |
| 19 | At first sight , this seems to be an attractive move : holding hearings behind closed doors has led to accusations that the Institute is protecting its own at the expense of the public interest . |
| 20 | line of type on its own at the top or bottom of a page . |
| 21 | But she comes into her own at the not-bloody-likely tea party ; and by the end , she has achieved just the right blend of poignancy and pride . |
| 22 | She had dreaded the moment when the food would be done with and the others would get up to dance , leaving her on her own at the table . |
| 23 | On her own at the till , Rachaela removed the extra pound and kept it . |
| 24 | We 've got one on her own at the end there , so . |
| 25 | She knew she was n't looking her best at the moment , but they looked the type to know quality when they saw it she thought , as she fluttered he awnings at them , colourless now , tattered and torn by the wind . |
| 26 | Her dreams were so vivid while the poem shimmered on her desk — signed , sealed , undelivered — that she had to catch herself from grabbing Lucy 's hands , kissing her right out in the street , holding her close at the end of each day , saying , come home , darling ; grabbing her and flinging her to the floor , ripping her clothes off , sinking into her breasts , fucking her like a sheet of flame . |
| 27 | They ‘ got away with it ’ with a half in bogey at the 19th , but they could not get their four at the 20th , where Tom Waugh , the son , holed an excellent putt . |
| 28 | As it was , the most she could hope for was his speedy return to Hong Kong , but for now she supposed she would just have to endure a certain amount of contact , as he had warned her earlier at the party just before leaving her with Cavell Fielding and Penny Seu Chen . |
| 29 | Dorothy looked determined rather than festive ; she would have been in her forties at the time but already stood as though planted , like an elderly woman . |
| 30 | His 141 at The Oval during which his finger was broken by South African paceman Rudi Bryson remains his side 's only century of the season . |