Example sentences of "[v-ing] [art] [noun pl] [noun sg] " in BNC.
Next pageNo | Sentence |
---|---|
1 | They confessed to such things as being in league with foreign powers , sabotaging economic projects , poisoning the workers food , causing railways accidents and plotting to assassinate Stalin . |
2 | Soon the stern anchor had been paid out and the Ariadne was back to where she had started , the buoy nudging the midships port side . |
3 | Christie , who stormed to the 100 metres title in 9.96 seconds , was even quicker to condemn the authorities for allowing the drugs saga to reach the Olympics . |
4 | PC Whitehouse , 24 , had felt the car was allowing the police car to draw close . |
5 | It may happen when parents have indoctrinated their children , that is , laid down a set of beliefs without allowing the children freedom to think for themselves and to come up with their own reactions . |
6 | We will be contacting the arts council with revised estimates showing the results of the grant standing still and with some views as to how the deficit can be reduced , ’ Mr Dunlop said . |
7 | Upon contacting the police station , that solicitor was told that C did not want a solicitor . |
8 | One elderly Palestinian in Beirut wanted to draw a map of his olive grove for me and spent ten minutes sketching and re-sketching the roads south of Jaffa . |
9 | Schistosome DNA prepared from male ( b , d and f ) and female ( a , c and e ) cercariae shed from snails infected from single miracidia , and thus essentially cloned , was amplified using the primers 5'-GTGAAATTCTTCCTTCACAC and 5'-GACATTCAACTCAATGTTCG for the amplification of the repetitive female specific sequence W1 ( 3 ) . |
10 | The LSA-1 gene was amplified for 35 cycles from nt , 5,372 to nt 5,701 ( ref. 25 ) using the primers GTGCTGAATATGACGATTCA and CCTTTTCCTTATTAACCTGC , in a buffer with 1mM MgCl and 10% DMSO , with annealing at 55°C . |
11 | Both these experimental conformations and the model conformations obtained with JUMNA are analysed using the CURVES algorithm ( 26,27 ) which determines a full independent set of helicoidal parameters related to an optimal curvilinear helical axis . |
12 | Using the Windows software supplied with the printer it is possible to setup , configure and maintain your printer from the comfort of your PC screen — no more fiddling about with mysteriously labelled buttons and switches , or peering hopelessly at a badly lit LCD panel . |
13 | It is generally accepted that an analysis of functions ( ie using the FAI ) is a prerequisite to the use of the other instruments , as illustrated in 14.4 , which shows the planned sequence of application for the study ; moving from the method tailoring phase to the development of the requirements specification , followed by an evaluation of the proposed system in the final stages using the Benefits Analysis Instrument . |
14 | As I understand it , disabled people were using the Friends Meeting House for their meetings , but with the pedestrianisation they ca n't very well get their vehicles along during the day . |
15 | People are using the words Oscar and Pauline Collins in the same sentence . |
16 | Students are taught , for instance , to ‘ read ’ in a different way from that of everyday practice : rather than reading a text from beginning to end in the sequence in which the publisher has ordered it , they are urged to select what they want for particular purposes from different parts of the text , using the contents page , index , chapter headings etc. and moving backwards and forwards within that text and to other texts . |
17 | Consider using the points system to help you . |
18 | In our implementation , aggregation was achieved at run-time through masking out components of the primary key and assembling , using the Protocols language , the series of text objects meeting the criteria implied by the user 's current request . |
19 | Using the applications designer , you can design forms , menus , and reports in full Windows fashion , using point and click , as well as drag and drop . |
20 | Prudential , the UK 's largest life company , has announced restated 1991 results for its life and pensions business using the accruals method . |
21 | Second , how to explain other ( earlier ) classical evidence which seems imprecise in using the terms fideicommissum and legatum ? |
22 | Any object is defined in a hierarchical manner with increasing granularity using the terms class , type , subtype and instance . |
23 | The Severn Auxilliary Rescue Association has been helping the police search the River Severn and surrounding areas . |
24 | Think of not bracing the knees back ( for excess tension in the legs ) . |
25 | Thora Hird on the cover and editing the letters page , Nick Drake to review the singles , Neil Kinnock to review the LPs , Archie Duke and The Ostrich to be in charge of the live section and an 18-page feature on Half Man Half Biscuit |
26 | Now that the results of our efforts are showing in a return to profitability , everyone in Chemicals manufacturing knows that they have an important contribution to make in transforming the Chemicals business into a really successful part of Johnson Matthey . |
27 | CA-Unicenter for HP-UX has performed so well at four major beta sites says Islandia , New York-based Computer Associates International Inc , that the company is bringing the systems management product for mission-critical applications forward and it will now be generally available in the first quarter of 1993 . |
28 | The Kuwaiti Ministry of Public Works says the cost of completing the telecommunications tower in Kuwait City has risen to $175m from $110m : the increase is due mainly to damage done by the Iraqis during their occupation of the country , as well as changes in the project 's specifications and a rise in the cost of raw materials and labour . |
29 | He will let Cardiff know before the end of the month if he will accept their offer of a new contract , after completely rejuvenating the Arms Park side in his five months in charge . |
30 | The role of the Needs Analysis is essentially to reveal user-related issues that should be taken into account when producing the requirements specification in the latter stages of a study . |