Example sentences of "[num] in [noun] [unc] " in BNC.
Next page| No | Sentence |
|---|---|
| 1 | There was a further anti-government demonstration on April 12 in Bucharest 's Revolution Square organized by the Civic Alliance and other opposition groups . |
| 2 | Soccer almanacs record the final score that day as 2-1 in Algeria 's favour . |
| 3 | On March 24 , 1892 , Andrew Ernest Stoddart scored 134 in England 's 499 at Adelaide and England went on to record their largest winning margin against Australia — an innings and 230 runs — until the Oval Test of 1938 . |
| 4 | Actually , it was an inspired gamble — in his first , albeit injury-hit , season in 1991 Taylor took 54 wickets and last year he grabbed 67 in Northants ' championship chase and suddenly Ted Dexter and the England selectors were knocking on the door . |
| 5 | Although Atherton failed to reach 30 in England 's first Test defeat at Old Trafford , he and Gooch improved their record as one of the best opening partnerships in English history with stands of 71 and 73 . |
| 6 | President Franjo Tudjman and his ruling Croatian Democratic Community ( HDZ ) secured an overwhelming victory on Aug. 2 in Croatia 's first presidential and legislative elections since secession from Yugoslavia on June 25 , 1991 [ see pp. 38274-75 ] . |
| 7 | There were similar events on Jan. 1-2 in Lithuania 's capital , Vilnius , where Soviet Interior Ministry troops seized the Historical Institute and the former Communist Party central committee building , which was claimed by both the pro-CPSU party and the independent party ( recently renamed the Democratic Labour Party ) . |
| 8 | The match ended 5-3 in Repton 's favour , thanks to two goals by Richard Basnett , and others from Jim McDonald , Jimmy Tipper and Robin Powell . |
| 9 | Consequently , oligonucleotides in which contacting Gs were mutated ( mutant oligos I and III in Fig. 4A ) were synthesized and used for band-shifting experiments . |
| 10 | , Sir William Augustus ( 1842–1926 ) , chemist , was born 15 August 1842 in Regent 's Park , London , the elder son ( there were no daughters ) of Augustus Tilden , a clerk of the Bank of England , and his wife Anne , daughter of Henry Balls of Cambridge . |
| 11 | The title has an added significance : Status Quo is in The Guinness Book of Records for having the greatest number of hit singles — 45 in band 's long career . |
| 12 | Since is non-basic there is currently no edge from I to J but we can always reach I from J in T because we can go from J to 1 and then from 1 to I. For example , if we take I = 3 and J = 7 in Fig. 8.1(a) , the unique paths from 7 to 1 and 3 to 1 are and and we can go from 7 to 9 to 1 to 9 to 2 to 3 . |
| 13 | Number three in Coleman 's Syrian rogues ' gallery was General Ali Issah Dubah , then chief of the Mogamarat , the Syrian secret service ( and now President Assad 's deputy chief of staff ) . |
| 14 | Erm looking interestingly enough , at the Hambleton figures of I understand these are new purchases , which is a bit surprising perhaps , but over a two year period there erm this is table three in Hambleton 's submission , there 's a reference to the number of erm the origin of house purchases from Cleveland in Hambleton , and it would be seen from there that Cleveland erm produced a hundred and fourteen dwellings , that 's purchases of Cleveland residents in the Hambleton area erm in nineteen ninety one to ninety three . |
| 15 | Now I 'm ha I 'm handing round a summary of last week 's lecture , which I hope will make more sense of it , and I have here , if anybody wants to borrow it , a Xerox of chapter three in Dorkins ' book where he explains the Blind Watchmaker , and the manual for the disk . |
| 16 | Sara and Thomas were to be in the cottage , and Simon 's household of three in Thomas 's place . |
| 17 | Jon Speelman , England number two , believes the chances are 55–45 in Karpov 's favour but I think it closer . |
| 18 | In Land ( state ) elections on April 21 in Kohl 's home state , the Rhineland-Palatinate , the CDU lost power for the first time since 1949 . |
| 19 | It is evident from the results shown in lanes 1–3 in Fig. 4B that pou[c] binds with high affinity to the HSV ICP4 TAATGARAT and the Ad2 degenerate octamer-TAATGAR motifs whereas binding to the canonical octamer sequence ( Ad4 ) was barely detectable even after overexposure of the GMSA signals . |
| 20 | , Henry ( 1647–1711 ) , architect and merchant , was baptized 8 July 1647 in King 's Lynn , Norfolk , the son of Henry Bell , mercer . |
| 21 | To construct a fusion between glutathione S-transferase ( GST ) and pou[c] a 1110 bp StuI- Xmn I fragment ( nucleotide positions 1317–2427 in Fig. 1A ) from pcZF20 encoding the C-terminal 267 amino acids of pou[c] was inserted into the Sma I site of pGEX-2T ( 52 ) yielding pZEX20 . |
| 22 | Figure 2.8 in Jones et al . |
| 23 | It was 3-1 in Hereford 's third division game … with United missing out yet again … |
| 24 | Scandinavian forces left England for Normandy in the summer of 1000 , and Swegen Forkbeard allegedly made an agreement with Richard II in Rouen c.1013 . |
| 25 | Arnott was unbeaten on 101 in Zimbabwe 's second innings total of 197 for one when bad light stopped play 50 minutes before the scheduled close . |
| 26 | In giving that advice , Mr. Workman relied upon footnote ( e ) to section 7(5) of the Bail Act 1976 in Stone 's Justices ' Manual , 121st ed. ( 1989 ) , vol. 1 , p. 128 , para. 1–476 , which states : |
| 27 | It ended 16-17 in Gloucester 's favour ; some comfort for Coach , Keith Richardson after a tricky season . |
| 28 | Messiah Anniversary Harry Christophers conducts the voices and orchestra of The Sixteen in Handel 's ‘ Messiah ’ on the very day of the 250th anniversary of its Dublin premiere on April 13 , 1742 . |
| 29 | For KOX2-related sequences , these primers were AK2A ( 5' AAATGCTGACTAAGGAACAAGGT 3' ; positions 110-132 in Figure 2a ) and AK2B ( 5' CCCTGTGTGTGTTCTCTGATG 3' ; positions 1086-1066 in Figure 2a ) giving a fragment of 977 bp ; for KOX31-related sequences , 4113 ( 5' GCCATAAGTCAGCTCTAATTG 3' ; positions 55-75 in Figure 2b ) and 4114 ( 5' GCTTTACATTCCACAATATACATC 3' ; positions 904-881 in Figure 2b ) giving a fragment of 850 bp . |
| 30 | Fresh from his 78 and five for 41 in Sunday 's drubbing of Merionethshire , Roberts is not the only player likely to cause Flintshire problems . |