Example sentences of "[num] [prep] the [no cls] " in BNC.
Next page| No | Sentence |
|---|---|
| 1 | I think it 's six pounds fifty for the erm for the day . |
| 2 | I think it 's six pounds fifty for the erm for the day . |
| 3 | Billingsley and Chance ( 1988 ) analysed weekly data for the period from April 1982 to January 1986 for the S&P500 index . |
| 4 | For KOX21-related sequences , the oligonucleotide primers used were K21FOR ( 5' TGAAAAGTCAACCCTTACTCAAC 3' ; positions 56-78 of the KOX21 cDNA sequence : accession number X69115 ) and K21REV ( 5' GGCAAAATGTTTCCTATATTCAT 3' ; positions 974-952 of X69115 ) giving a fragment of 919 bp . |
| 5 | Such a number represented about one-half of the NAS&FU 's likely membership at the time and some two-thirds of all the foreigners sailing on British ships . |
| 6 | The LFS also allows agency workers to be distinguished , but these make up only some 50,000 of the l.5m temporary workers in Britain . |
| 7 | According to Centerline , version 4.0 of the C++ ObjectCenter will include new object-oriented class libraries , data storage functions and reusable code functionality for users switching from C to C++ . |
| 8 | However , noticeable modifications appeared upstream of -38 with the α-truncated RNA polymerases both in the presence and in the absence of CRP-cAMP at lac UV5 . |
| 9 | Larsson has described the implementation of CCL within the 3RIP search system at the Royal Institute of Technology Library in Stockholm . |
| 10 | Examples of ( b ) range from the New English Art Club of 1885 to the Société des Artistes Indépendants of 1884 ; such cases are especially numerous . |
| 11 | The regions contacted by the POU S and POU HD upon binding of Oct-1 to the Ad2 motif ( 24,26 ) are indicated . |
| 12 | In a detailed study of the contacts made between the isolated POU domain and POU HD of Oct-1 on the Ad2 sequence , Verrijzer et al . |
| 13 | I usually use the tubular cast on ( 2 on the E6000 ) for my full needle setting but you can use the racking cast if you prefer . |
| 14 | For the KOX31-related sequences , a PCR fragment of 850 bp was generated from all three templates ( corresponding to positions 55-904 of the KOX31 cDNA ; Figure 2b ) . |
| 15 | For the KOX21-related sequences , a PCR fragment of 919 bp was generated from the cDNA and yA4C5 ( corresponding to positions 56-974 of the KOX21 cDNA ; accession number X69115 ) . |
| 16 | This had grown out of his very successful Special Theory of Relativity which he had published in 1905 and which can account for two-thirds of the 43′ residual . |
| 17 | The first was an increase of the length of the blocked transcript by one and two nucleotides for many of the blockages exhibited by derivatives 2 , 3 and 6 ( eg. 44 and 45 for the UV5 derived transcripts ) accompanied by a time-dependent extension to the longer transcript over 5–15 min . |
| 18 | The homologue , 3 , which contains the longer - ( CH 2 ) 2 - linker also shows additional blockages at 47 for the UV5 promoter and 91 and 97 from the N25 promoter . |
| 19 | In program mode ( again , confirmed by an LED ) , six of the A4 's lower bank of footpedals select any of the user or factory complete patches . |
| 20 | Reports also indicated continuing differences over interest rates [ see pp. 37977-78 ; 38170 ; 38314 ] following a rise in inflation over the last year in six of the G-7 countries . |
| 21 | A move by six of the G-7 countries to set targets controlling greenhouse gas emissions was reportedly opposed by the USA , which challenged the claim that carbon dioxide emissions contributed to global warming . |
| 22 | The Park is on the main A6007 between Heanor and Ilkeston , just 8 clearly signposted miles from junction 26 of the M1 . |
| 23 | It was therefore something of a surprise last Wednesday to amble into Darlington 's new Thai restaurant and find four-fifths of the D&S editorial staff seated serendipitously to lunch . |
| 24 | Rank Motorway Services has opened a £7.9m service area on junction 47 of the M4 at Penllergaer , Swansea . |
| 25 | Disk 7 of the 3.5inch set of disks contains a whole host extra printer drivers for Windows . |
| 26 | More recently Shaw et al have sequenced exons 5 , 6 , and 7 of the p53 gene in 19 polyps without finding any mutations whereas Baker et al reported point mutations in 10% of 19 adenomas retaining both p53 alleles . |
| 27 | Glycine at position 79 , which is present in all H1 molecules , is involved in making a sharp bend in the polypeptide chain , in going from the end of helix III into the β -hairpin . |
| 28 | By 1930 , from 400,000 to 450,000 people were travelling in from the suburbs to work in Paris : 180,000 into the Gares Saint-Lazare , Montparnasse , and des Invalides , 90,000 into the Gare du Nord , 85,000 into the Gares de l'Est and de la Bastille , and 45,00 into the Gares d'Austerlitz , d'Orsay , and de Lyon . |
| 29 | Put my twenty one in the Whimby circle or Whitby circle , and the thirteen in the erm Scarborough circle . |
| 30 | It was therefore noticeable that instead of a tyrosine residue at codon 660 within the TK1 domain we found an isoleucine residue , and conversely , instead of an isoleucine at codon 829 in TK2 a tyrosine residue . |