Example sentences of "[det] [noun pl] [be] [no cls] " in BNC.

  Next page
No Sentence
1 Erm and I say this view is , is in some respects being er erm er expressed relatively early on .
2 I do like wedding cake but the only thing I do n't like in some cakes is ch
3 And the big , one of the big things that affected us in the last few years was er Dallas .
4 I think there 's something there cos some things are er do n't have any logic
5 er , so I 've a , is n't it , it 's a case of no news is possibly good news again , erm , I 'm trying to get in touch with the National Co-Organiser for Carl and John without er any success erm , I know he was going to the erm , the British Section just erm , he was gon na check on them and what actions were forthcoming but er , I have n't heard about that erm , I dare say there 's some on the way erm , the erm , the other few points were erm Jackie 's talk last month she mentioned that erm she was gon na give sort of the more forms sort of side presentation and stuff at their centre in North London , I 've got ta date for that now , it 's erm the eighteenth of March , which is a Wednesday so eh , I 'll certainly be going , if anybody else is interested that 's er , that 's the date er , it 's , it 's not entirely to do with but it , it has a link in , erm we were mentioning campaigns last month , I believe there 's a fourth coming one on , indigenous peoples , which , er , it 's , it 's all sort of triggered off by erm the er five hundredth anniversary of Columbus discovering the Americas erm , the erm cast and the whole of all the sort of the Region and Action networks and the Americas are , erm gon na have a big link in with that campaign so , erm , I , I 'd really like to see us sort of getting involved with that , yes , and , I mean , I 'll be involved to an extent anyway , cos some of the actions that I 'll getting will be sort of addressing the issue of indigenous people 's but erm , erm , they if , if nobody else is wiling to take it on , I 'll , I 'll , I 'd certainly be prepared to erm , sort of co-ordinate that campaign , erm , having said all that , erm I mentioned to a few people that erm , erm in the process of buying a house , so erm I could be moving in well hopefully as little as two months time so erm , I mean if er is as quite as it has been for the last few months , I probably wo n't have any problems , but erm , sod 's law it 's bound to pick up just as I 'm moving house
6 An alternative term for such flows is nuées ardentes ( literally burning clouds ) .
7 Following the decision of the House of Lords in Hazell v. Hammersmith and Fulham London Borough Council [ 1992 ] 2 A.C. 1 that all such transactions were ultra vires the local authority concerned and void ab initio , the banks claim the return of the above-mentioned sums on a restitutionary basis on the footing that the consideration for which the respective agreements were concluded has wholly failed ; that the payments were made under a mistake of fact so that it is unjust and unconscionable that Glasgow should be entitled to retain them ; that the sums are money had and received for the use of the banks ; that the sums are held by Glasgow on implied or resulting or constructive trusts of the bank ; and that the banks are entitled to trace them .
8 Whether or not all such bodies were bona fide trade unions seems to be questionable .
9 When a run was done using a lexicon without letter names , the number of paths produced was a few orders of magnitude less than when these words were included.2 Similarly function words could be treated differently from content words .
10 One of these combinations is p53 and c-ras , both frequently activated in large bowel cancers .
11 One of these cantatas is La colère d'Achille .
12 And I can only really regret with er with hindsight that er we as a District Council did n't pursue our point er more vigorously , erm as our general approach to these matters is er to cooperate as far as we possibly can rather than enter into conflict , and I think that perhaps we had n't given as much emphasis to er the er our views as we ought to have done .
13 who speaks to you , er it 's easy enough to just er have the microphone handy that they do n't see and just switch the tape on and I 'll record what they 're saying , come away , see , do it secretly like that , they do n't have to know really that they 're on tape and it does n't really matter , I mean the people who will listen to these tapes are er anonymous you know
14 These problems is erm young people , using fireworks in not the proper manner .
15 But erm do n't forget that all these things are erm a little bit dodgy at your ages , I do n't think you should be making big transfers at this stage , simply because you may need the money .
16 For KOX2-related sequences , these primers were AK2A ( 5' AAATGCTGACTAAGGAACAAGGT 3' ; positions 110-132 in Figure 2a ) and AK2B ( 5' CCCTGTGTGTGTTCTCTGATG 3' ; positions 1086-1066 in Figure 2a ) giving a fragment of 977 bp ; for KOX31-related sequences , 4113 ( 5' GCCATAAGTCAGCTCTAATTG 3' ; positions 55-75 in Figure 2b ) and 4114 ( 5' GCTTTACATTCCACAATATACATC 3' ; positions 904-881 in Figure 2b ) giving a fragment of 850 bp .
17 Any exercise of discretion which contravenes these limits is ultra vires .
18 Well the these exercises are erm designed so as that you will remember .
19 @TAB1 = Element selected % @TAB1 = Martian 100 @TAB1 = human expedition30 @TAB1 = Mars 67 @TAB1 = Terran 100 @TAB1 = human colony 87 @TAB1 = Luna 100 @TAB1 = interplanetary trip 97 @TAB1 = free-fall orbits 97 @TAB1 = Terra to Mars 87 @TAB1 = Terran days 67 @TAB1 = Mars 24 @TAB1 = planets 47 @TAB1 = return orbit 100 @TAB1 = space station 87 @TAB1 = Envoy 50 @TAB1 = Mars 10 @TAB1 = reaction tanks 90 The mean average across all of these percentages is 72.94% .
20 Among these stages are CD4 - CD8 - IL-2R + TCR - ( double negative , or DN ) and CD4 + CD8 + IL-2R - TCR low+ ( double positive , or DP ) cells , both of which are important control points at which some signal or stimulus from the thymic microenvironment is suspected or known to be required for proliferation or differentiation to proceed .
21 But nevertheless it 's im important to remember that this is a survey erm which is conducted at the time of year when most compan or many companies raise their list prices and if one looks at the past sort of record of this survey both at the regional level and the national level , one generally does see a bit of an upturn in the pr in the prices numbers at this time of year because people are raising their list prices erm and once you allow for that erm I think these numbers are er very good in terms of prices trends , very low for the time of year .
22 All these booklets are o on display just inside the general office , Right , now another way contact my is in Cardiff , I know yours is n't up to local or if no it is n't it
23 These nominations are do , clearly written .
24 Eating disorders tend to come from childhood , or problems , or ways people have approached food in the past and the pressure is on women to be slim to fit into these categories are er , just more pressures that make it very difficult for somebody who has an eating disorder to sort the problem all these pressures just make it more difficult .
25 The ranges of density of oil workers in these categories were <=4.81; oil workers per 1000 economically active men ( low ) , 4.82–10.56 ( medium ) , and >=10.57; ( high ) .
26 All bedrooms are en suite and have colour TV , hairdryer , telephone and hospitality tray .
27 Suppose that the spot exchange rate is e o = 2.0 , the real interest rate in all countries is = 3% , = 0.10 and = 0.05 .
28 Bourner and Hamed ( 1987 ) conclude that 39.5% of those graduating from CNAA full-time or sandwich degrees in 1983 who had non-standard entry qualifications obtained ‘ good ’ degrees ( firsts or upper seconds ) , while only 34.9% of graduates who were A-level entrants achieved ‘ good ’ degrees , and the figure for all entrants was 35.8% .
29 In some of the mesenteric lymph node specimens , however , many macrophages were CD68 + L1 + , perhaps because of the comparatively increased traffic of mononuclear cells as suggested by comparatively pronounced sinus histiocytosis ; on average , 50% of all L1 + cells without granulocyte markers expressed CD68 in these nodes ( Fig 3A , Table VI ) .
30 All wines are 75cl size unless otherwise indicated .
  Next page