Example sentences of "[pron] [adj] at the " in BNC.
Next page| No | Sentence |
|---|---|
| 1 | It was claimed that soldiers on a British training exercise had been caught by a fearsome ‘ flame weapon ’ which had burned dozens of them alive at the water 's edge . |
| 2 | Need a the , these Fiestas , but they never get them right at the , the bloke I works with got one exactly the same as this does exactly ten miles and it cuts out on him . |
| 3 | Victory for the Cherry and Whites could take them clear at the top of the Courage League , if Orrell and Leicester come unstuck . |
| 4 | ‘ We investigated , as we are obliged to , but found nothing wrong at the club . ’ |
| 5 | two hundred to my right at the back , at two hundred pounds thank you , six one O at two hundred pounds . |
| 6 | Someone concerned at the suffering might well think it more appropriate to work for reformation rather than abolition . |
| 7 | And I , and I mean it 'll be Terry and I available at the time cos I |
| 8 | The time has come for us all to speak out , to make it clear that we are behind her in feeling that we need someone new at the helm . ’ |
| 9 | They were knocked out of the Anglo-Italian Cup by Portsmouth , who beat them two-nil at the Manor . |
| 10 | Topaz was trying to pretend that this man was n't making her weak at the knees . |
| 11 | Slowly , carefully , he pushed her away from him , flicking his lazy dark eyes over her nakedness before reaching to pull her swimsuit back up again , smoothing it over her body with a practised skill which left her weak at the knees all over again . |
| 12 | Startled , she looked up into Dane 's sea-blue eyes , and even as she tried to strengthen herself against him she felt a rush of longing so intense that it made her weak at the knees . |
| 13 | He grasped her suddenly nerveless fingers in his hand , sending her a smile with enough voltage to make her weak at the knees . |
| 14 | It 's a challenge all the more remarkable for the fact that not so long ago jetting off on holiday made her weak at the knees … |
| 15 | Nigel had once made himself unpopular at the office by writing in his column that women past thirty should shoot themselves . |
| 16 | Eb was making himself comfortable at the head of the table . |
| 17 | Recombinants ‘ oligo I ’ and ‘ oligo III ’ were produced by cloning the sequence CTGGGGAGGCGACCCCTCCCCCCTTGTCCCGACT ( nts -527 to -494 ) and its complementary or the oligonucleotide TCGCCCAGCTCAGGGCCGCGTGTGTTAGTT ( nts -479 to -450 ) and its complementary at the HindIII site of plasmid pBLcat2 ( 16 ) . |
| 18 | ‘ There is a tide in the affairs of man , which taken at the flood , leads on to … ’ heaven knows what and where . |
| 19 | By late March they were in Bologna , where Wolfgang was put through his paces by the famous theorist Padre Martini , who professed himself amazed at the boy 's ability to work out complex fugues on a brief given subject . |
| 20 | After the Nuuk meeting Danish Environment Minister Svend Auken declared himself disappointed at the " lack of political will " to tackle the problem . |
| 21 | There was admittedly a fiki but he was very restrained and seemed anxious to keep himself invisible at the back . |
| 22 | Her dreams were so vivid while the poem shimmered on her desk — signed , sealed , undelivered — that she had to catch herself from grabbing Lucy 's hands , kissing her right out in the street , holding her close at the end of each day , saying , come home , darling ; grabbing her and flinging her to the floor , ripping her clothes off , sinking into her breasts , fucking her like a sheet of flame . |
| 23 | It seemed to me obvious at the time that to be a child was safer and easier than to be adult and that , specifically , to be a girl was safer and easier than to be a woman . |
| 24 | What time you due at the hairdresser , quarter to ? |
| 25 | Are you free at the weekend ? ’ |
| 26 | What are you curly at the back ? |
| 27 | You okay at the moment ? |
| 28 | It is as well that she has chosen to stay with you this evening because there is no way I will leave you alone at the farm . ’ |
| 29 | An excursion to the top of the high alpine road of Gross Glockner will leave you breathless at the fantastic views stretching as far as the eye can see in every direction . |
| 30 | Were you aware at the time that it was a small house ? |