Example sentences of "[pron] [adj] at the " in BNC.
Next page| No | Sentence |
|---|---|
| 1 | It was claimed that soldiers on a British training exercise had been caught by a fearsome ‘ flame weapon ’ which had burned dozens of them alive at the water 's edge . |
| 2 | Need a the , these Fiestas , but they never get them right at the , the bloke I works with got one exactly the same as this does exactly ten miles and it cuts out on him . |
| 3 | Victory for the Cherry and Whites could take them clear at the top of the Courage League , if Orrell and Leicester come unstuck . |
| 4 | ‘ We investigated , as we are obliged to , but found nothing wrong at the club . ’ |
| 5 | two hundred to my right at the back , at two hundred pounds thank you , six one O at two hundred pounds . |
| 6 | Someone concerned at the suffering might well think it more appropriate to work for reformation rather than abolition . |
| 7 | And I , and I mean it 'll be Terry and I available at the time cos I |
| 8 | I was training on my own at the time , and seemed to be constantly injured , so I was n't racing much . |
| 9 | But I remembered her asking whether I did n't go crazy on my own at The Pightle . |
| 10 | The time has come for us all to speak out , to make it clear that we are behind her in feeling that we need someone new at the helm . ’ |
| 11 | They were knocked out of the Anglo-Italian Cup by Portsmouth , who beat them two-nil at the Manor . |
| 12 | Topaz was trying to pretend that this man was n't making her weak at the knees . |
| 13 | Slowly , carefully , he pushed her away from him , flicking his lazy dark eyes over her nakedness before reaching to pull her swimsuit back up again , smoothing it over her body with a practised skill which left her weak at the knees all over again . |
| 14 | Startled , she looked up into Dane 's sea-blue eyes , and even as she tried to strengthen herself against him she felt a rush of longing so intense that it made her weak at the knees . |
| 15 | He grasped her suddenly nerveless fingers in his hand , sending her a smile with enough voltage to make her weak at the knees . |
| 16 | It 's a challenge all the more remarkable for the fact that not so long ago jetting off on holiday made her weak at the knees … |
| 17 | Equilibrium is at its lowest at the water 's surface and as pressure is exerted on the bladder its volume decreases which causes the fish to ‘ sink ’ . |
| 18 | Nigel had once made himself unpopular at the office by writing in his column that women past thirty should shoot themselves . |
| 19 | For instance , when the selectors were working at their hardest at the English and British Match-Play Championships — Joanne was feeling and playing far below her best because of a species of salmonella food poisoning . |
| 20 | Eb was making himself comfortable at the head of the table . |
| 21 | This was the first of the eight birdies Davies gathered , the best of all being her three at the 315-yard 13th hole , where she drove the green . |
| 22 | Then we 'll meet ye all at the Curragh Bar for a few good old jars , and then we 'll go on to the hotel . |
| 23 | Nevertheless the book does provide a detailed description of present practice and consumer views , against which those at the vanguard of community care developments could usefully compare their practice . |
| 24 | If one broadens that range and spreads it more evenly , one gets away from the present situation in which those at the bottom end of the range are paying more than they need to pay because of the way the system has been constructed . |
| 25 | Recombinants ‘ oligo I ’ and ‘ oligo III ’ were produced by cloning the sequence CTGGGGAGGCGACCCCTCCCCCCTTGTCCCGACT ( nts -527 to -494 ) and its complementary or the oligonucleotide TCGCCCAGCTCAGGGCCGCGTGTGTTAGTT ( nts -479 to -450 ) and its complementary at the HindIII site of plasmid pBLcat2 ( 16 ) . |
| 26 | ‘ There is a tide in the affairs of man , which taken at the flood , leads on to … ’ heaven knows what and where . |
| 27 | The great problem for any navigator was to know where his ship was : it was relatively easy to determine the latitude , which measures distance north or south of the equator , but it was much harder to find the longitude , or distance east or west of a fixed meridian — a line from pole to pole running through all the points at which the sun is at its highest at the same moment . |
| 28 | The letter concluded : ‘ Convinced Nazis who are really inwardly certain of our final victory do n't seem to be too plentiful even among people who have otherwise courageously held their own at the Front . |
| 29 | On the other hand , Ken has been remembered and widely admired , not only by the Oxford Movement and their successors , as the noblest , most saintly and most charitable representative of the hundreds of Anglican clergy who had grown up under Puritan rule , sustained in their faith by the memory of King Charles the Martyr , ; they had come into their own at the Restoration but had later given up comfortable benefices to live in poverty , out of a scrupulous loyalty to a monarch to whose ecclesiastical ambitions they were utterly opposed . |
| 30 | Similarly a grant is paid to staff who move from a rented unfurnished house or flat to a similar property at the new base or who buy a house of their own at the new location . |