Example sentences of "[verb] with the [num] " in BNC.
Next pageNo | Sentence |
---|---|
1 | This month saw a special range of squeaky toys for dogs designed with the 1992 Barcelona Olympics in mind . |
2 | But there was little sign of an Englishman in this English Open , staged at a re-styled Belfry which now boasts new bunkers and spectator mounds designed with the 1993 Ryder Cup in mind . |
3 | THE old west , as the legend goes , was won with the three Gs : God , guts and guns . |
4 | The four cylinder diesel units will interchange with the four cylinder petrols with suitable pipework and wiring and throttle linkage . |
5 | In order to keep the level of inflation down , will he have a look at what is happening with the six major grocery chains , the increased share of the margins that they are getting and the fact that their margins are now twice the level found in the major grocery chains throughout Europe ? |
6 | For a hybrid motor the pull-out torque is maximised with the two-phases-on excitation sequence : . |
7 | The Japanese Ministry of Education 's National Institute of Fusion Science says that its NEC Corp SX-3 Model 24 supercomputer successfully fulfilled all the requirements specified in the initial contract bid : the contract was concluded last June , and was the subject of a challenge by Cray Research Inc late last year , and Cray was permitted to observe the operation of the new computer ; according to the Nikkei Industrial News , Cray complained that it was unable to obtain sufficient data on hardware issues such as NEC magneto-optical installed with the SX-3 , which NEC claims are the fastest in the world , and on the ultra high-speed HIPPI channel linked to them ; on the software side , Cray said that it was not able to obtain information on the efficiency of the automatic parallelising function ; for its part , NEC announced simply that the supercomputer was in full operation . |
8 | In September 1962 Sylvia Plath separated from her husband and moved with the two small children to a flat in London . |
9 | Their statement was interpreted as an attempt to distance themselves from the so-called ‘ Central Belt activists ’ who withdrew their strongly worded motion at the executive and voted with the six on the statement drawn up by Councillor Rob Gibson which regretted the MPs ' actions . |
10 | Our results suggest that DNA binding to a sequence over the transcription initiation site is not sufficient for autoregulation as protein VT2 specifically interacts with the HSV-1 IE-3 consensus site yet evidence from transfection assays ( 17 ) and also the recombinant HSV-140 virus ( 13 ) suggests that intact 140k fails to repress this IE-3 promoter . |
11 | See the , we used to work with the five . |
12 | At last , the morning came when Oliver was allowed to go out to work with the two other boys . |
13 | It seemed to work with the Div 4 winner on 129 plus 5 . |
14 | However , Mr Ridley said the Government disagreed with the five main findings of Sir Anthony Barrowclough , the Parliamentary Commissioner for Administration , whose 170-page report was released yesterday after a 13-month investigation . |
15 | Sealink disagreed with the MMC's findings that reduced choice , higher fares and a poorer quality service would result in the pooled operation before the tunnel 's opening . |
16 | As previously described , the northern blot results were normalised by rehybridising the filters with a P 3 2 -labelled oligonucleotide ( 5'AACGATCAGAGTAGTGGTATTTCACC 3' ) that corresponds with the 28s ribosomal ribonucleic acid . |
17 | When this shortened cDNA was transfected into COS 7 cells , we observed high level expression , as shown by a complex comigrating with the N-Oct 3 protein and , surprisingly , an additional double band complex comigrating with the two N-Oct 5 complexes of the brain extract ( Figure 3a , lane 6 ) . |
18 | All these hits are resolved with the +1 strength bonus . |
19 | We forgot to mention that as an added bonus the winner will be presented with the 555 by Paul Chandler himself at the London Music Show ‘ 92 , so get dialling and it could be you . |
20 | There are in fact three known marks for the Hotteterres , which we can associate with the three sons of Loys de Haulteterre as follows : |
21 | Find the pull-out torque at 500 steps 51 if the motor is operated with the one-phase-on excitation scheme and the drive circuit has supply voltage 30 V and forcing resistance 9 ohms . |
22 | Additionally , Library staff can access Altos files of catalogue information for about 6,000 records , and this data will be transferred and merged with the 1,000 records available on the new Soutron Library System . |
23 | The sounds built , the creaks got louder , her mind was absorbed with the two of them together . |
24 | The Captain 's band of child criminals invite you to mingle with the 1807 action in Bartholomew Fair , Smithfield ( box office : 01 278 6563 ) . |
25 | as has been done with the two examples in the previous section . |
26 | I could have done with the two hundred and thirty quid though |
27 | First , there are the structures as objective relations between agents ( possessed with the three types of capital ) in the fields . |
28 | This occurs with the 17.56 Machynlleth to Aberystwyth which on arrival in Aberystwyth at 18.28 is shunted . |
29 | People wore different clothes , shopped in privately-owned shops and were able to talk with the thousands of foreigners living , working in or touring China . |
30 | Public health doctors are more likely to influence public health if they collaborate with the million or so people employed in the health service . |