Example sentences of "were used [verb] the [adj] [noun sg] " in BNC.
Next page| No | Sentence |
|---|---|
| 1 | A fundamental dis-continuity between human thinking and non-human thinking is already presupposed in the very arguments which were used to describe the imagined evolution from the one to the other . |
| 2 | Before multiple regression analysis , univariate tests were used to assess the independent effect of each factor on height velocity . |
| 3 | The inserts from four such M13 recombinants ( AS22 and AS136 for the largest subunit , AS1 and AS90 for the second largest subunit ; see Fig. 1 ) were used to map the corresponding ASFV genes by dot-blot hybridization . |
| 4 | Smaller versions , engraved by James Smith , were used to illustrate The Flower-garden Display 'd ( 1732 ) with descriptions of the flowers probably written by Richard Bradley [ q.v. ] , and another set of small copies was issued by John Bowles in 1749 as Flora . |
| 5 | A panel of monoclonal antibodies were used to characterise the gastric lymphoma in all 50 patients who had undergone surgery . |
| 6 | The avidin-biotin complex method followed by DAB visualisation were used to show the EGF-antibody complex . |
| 7 | The gas yields , determined at 550°C , plotted against the vitrinite reflectance of the unheated coal ( Fig. 3 ) were used to reconstruct the cumulative gas yield for the Palaeozoic coal between 0.4 and 2.9% reflectance ( Fig. 4 ) . |
| 8 | These expected numbers were used to weight the observed incidence rates . |
| 9 | Medium-sized gouges were used to start the basic roughing out of the shape , with references made to the life model to get the proportions absolutely right . |
| 10 | Radiology of the small intestine and either double contrast barium enema or colonoscopy were used to determine the anatomical distribution of disease . |
| 11 | The second and third 15 minute basal collections were used to determine the basal output . |
| 12 | Counter-balance weights were used to reduce the necessary lifting force , but leaving sufficient unbalance for the gates to be shut by gravity . |
| 13 | But comradely conversation shows that I 'm not the only one nervously remembering 1970 , when faked opinion polls were used to rally the Tory vote . |
| 14 | Michael Blaese ( NIH ) described studies in which T cells transformed with a retrovirus encoding adenosine deaminase ( ADA ) were used to correct the crippling immunodeficiency produced by a lack of this enzyme . |
| 15 | Subsequently , specific primers as follows were used to complete the full length sequence : for KOX2 , primers 748 ( 5' CAAGGTAATGTAATAGGAATA 3' ; positions 127-147 of Figure 2a ) , ED1/K2 ( 5' GCATGATGAAACTCATAC 3' ; positions 318-335 ) , ED4/K2 ( 5' TATAATGAATTTGGGAGA 3' ; positions 520-537 ) , and ED7/K2 ( 5' AAGTTCTTATGTGTGAAG 3' ; positions 619-636 ) ; for KOX31 , primers 4113 NEST ( 5' ATTGTACATCAGAGAACCC 3' ; positions 72-90 of Figure 2b ) , ED2/K31 ( 5' GTGGAAAAATCTTTTACC 3' ; positions 292-309 ) , ED5/K31 ( 5' TGGATATTAGAAATTTCC 3' ; positions 454-471 ) ; for KOX21 , primers K21NEST ( 5' TTACTCAACATCAAAGAACG 3' ; positions 70-89 of X69115 ) , ED3/K21 ( 5' GGAAGTCATTCTCTGAGA 3' ; positions 295-312 ) , and ED6/K21 ( 5' GAAAATCATTCTATGTTA 3' ; positions 631-648 ) . |