Example sentences of "be [verb] [prep] an [adj] [noun] " in BNC.
Next pageNo | Sentence |
---|---|
1 | Of the 195 members of the Paris Academy of Sciences to be honored with an official eulogy before the Revolution of 1789 , at least twenty percent had received a Jesuit education . |
2 | Variation was entirely random , and each population evolved in response to purely local environmental pressures , which could be altered in an unpredictable way by migration or geological changes . |
3 | The trouble with nuclear power is that its ‘ costs ’ always have the potential to go well beyond the point where they can be factored into an environmental bill . |
4 | Coaching is also beginning to be recognized as an essential tool which has to be developed systematically , not left to chance or the interest of a few concerned managers . |
5 | In whatever sense it is to be recognized as an objective fact that I am now responding in awareness of more factors than before , my reaction will likewise be objectively better than before . |
6 | In fact , our research shows that sensitivity needs to emerge from the shadows and be recognized as an important problem in research . |
7 | It is good that the demanding job of running hostels for the mentally ill and the mentally handicapped , together with other provision of residential care , should now be recognized as an important aspect of social work , for much needs to be done in this field and many able people need to be recruited for the work . |
8 | As of now , IBM Corp is offering an anti-virus service to its UK customers : this comprises updates to anti-virus programs four times a year — these provide users with ‘ install-and-forget ’ automatic protection on MS-DOS , OS/2 and Microsoft Corp 's Windows operating systems , and can detect viruses in the memory , on floppy and hard disks ; if viruses are found in the memory , they are disabled , but if found on disks the user is given a recommended course of action on-line ; other services consist of detection tools for any new viruses ; access to an anti-virus bulletin board , from which the latest products and documentation can be downloaded ; phone support desk ; and customer alert service to forewarn of known or threatened virus outbreaks ; prices will be amended on an annual basis , but for one to 250 machines , the service is £1,000 , on 3,001 to 5,000 workstations it is £12,000 . |
9 | As we have seen , this gain is a loss to the welfare of consumers in the country to which they are exporting , and the cartel would , therefore , presumably be disallowed by an international competition authority . |
10 | This inspection should then be repeated every ten years so that remedial treatment can be undertaken at an early stage if rotting is detected . |
11 | This work will be undertaken by an interdisciplinary team from both Leicester and Loughborough Universities in collaboration with research staff at the British Geological Survey and neighbouring local authorities . |
12 | Having decided that an environmental impact study was necessary , it wanted the study to be undertaken by an independent group which would be more sympathetic to community concerns and interests , rather than have such a study conducted by a government agency such as An Foras Forbartha . |
13 | Sometimes decline can be explained as an inevitable concomitant of development ; thus the heyday of Valencian prosperity was matched by a dramatic decline in the silk industry of Granada and the smaller industry of the Aragonese valleys may have suffered from Catalan competition . |
14 | The effect of the GC step in the context of GGGCCC motif seems to be about as large as that of AA/TT , i.e. it is apparently enough to cancel the macroscopic curvature of helically phased A-tracts.The origin of the macroscopic curvature for the ( AGGGCCCTAGAGGGGCCCTAG ) n DNA can be explained by an overall roll angle difference between the GGGCCC and CTAGAG sequence elements , which will add up if the two motifs are separated by a distance close to the helical repeat length . |
15 | The finding therefore of an increase in collagen-stimulated thromboxane production by CS 11 could be explained by an increased availability of arachidonic acid from membrane phospholipids ( Jackson et al , 1984 ) . |
16 | The high proportion of symptomatic patients without detectable pathogens especially at early stages of HIV infection , and furthermore the poor correlation of infections and symptoms might be explained by an enteropathogenic role of HIV itself . |
17 | The difference in the frequency of symptomatic recurrence may be explained by an evolving policy of management when considering gall stone patients for non-surgical treatment . |
18 | His psychological theorizing developed throughout his life , but many of the assumptions he made can be traced to an early work , the " Project for a Scientific Psychology " . |
19 | More frequently , the cause of problems can be traced to an excessive desire to stick to policies or to a lack of understanding by the planning officers of the realities of life for developers and occupiers of property . |
20 | Andersons 's insistence that the notion of social class must be defined in structural terms can be traced to an over-riding commitment to holism . |
21 | Even where such process does not demonstrate the incompatibility of the firms seeking a merger it will frequently happen that the actual merger will need to be delayed for an agreed period so as to phase in the new arrangements . |
22 | Obviously people still belong to classes , but belief in the decisive universal agency of the dwindling proletariat is something which must be dismissed as an idealist fantasy . |
23 | By those who treat scientific and religious discourse as two distinct language games , or who detach doctrines of creation from statements about the physical world , Drummond 's attempt to integrate his faith with evolutionary science would be dismissed as an unfortunate error . |
24 | I do n't chatter and allow myself to be dismissed as an old fool ! ’ |
25 | If individuals have personal difficulties that do not impinge on their functioning at work they can be assessed under this agreement : the individual would then be referred to an appropriate specialist agency for ongoing work outside the agreement , on a personal basis and without commitment on RBGE 's part . |
26 | Questions , however , might arise about whether a dispute is a valuation/technical dispute to be referred to an expert or one that should be referred to an arbitral tribunal or the court . |
27 | The headnote in the Weekly Law Reports is wrong : it states that the lease provided that disputes were to be referred to arbitration , whereas in fact the lease between Ipswich and Fisons said that if Fisons did not accept Ipswich 's terms the matter should be referred to an independent expert . |
28 | In the event of any dispute or difference between the parties hereto concerning any matter of thing arising under this agreement such dispute or difference shall be referred to an independent surveyor agreed between the parties hereto or in default of agreement to a surveyor appointed for the purpose on the application of either party by the President for the time being of the Royal Institution of Chartered Surveyors who shall act as an arbitrator pursuant to the Arbitration Acts 1950 to 1979 or any statutory re-enactment thereof for the time being in force |
29 | Social workers may be involved in bargaining with carers over how much assistance can be given to an elderly person , and how much support from services may be required to make the situation manageable for them all . |
30 | The role of judge can not be left to the exchange prosecutors , but must be given to an independent adjudicator or tribunal . |