Example sentences of "we [vb past] that the [adj] [noun] " in BNC.
Next page| No | Sentence |
|---|---|
| 1 | Nevertheless the subject was not forgotten , and we agreed that the average funeral was a complete waste of money which , instead of mourning the dead , should be spent on celebrating their lives . |
| 2 | We agreed that the prime minister had now definitely lost the coming election . |
| 3 | so we agreed that the next time a priest was around |
| 4 | After talks with BR 's Chairman , Peter Parker , we agreed that the sensible way forward was for a new company , British Rail Investments , to be formed and for the subsidiaries to be transferred to the private sector , with the proceeds going to British Rail . |
| 5 | When we submitted our first Report on the primary stages we recommended that the three profile components , speaking and listening , reading and writing , should be weighted equally in the assessment process . |
| 6 | How little we realised that the front line was a focus , that it was important to the Lebanese , the only way to define the undefinable , the only method by which those who had suffered — which meant every Lebanese — could uniquely understand the nature of the calamity that had come upon them . |
| 7 | After snarling a few choice remarks at them from the corners of our mouths , such as , ‘ Get lost ! ’ or ‘ Beat it ! ’ , which we understood to be good American for , ‘ Please go away , we do not wish for company , ’ we managed to rid ourselves of a few of them , but two of the most persistent followed us until we were clear of the town , and then we realised that the only way to be left alone was for us to be really rude . |
| 8 | ‘ We realised that the whole psychology of collecting is a fascinating area and that it had a lot more potential … hence the reason for the Festival . |
| 9 | That is when we realised that the materialistic gap between the rich and poor was indeed nothing compared to the wide gulf in understanding , and that the understanding of health problems in this country would take a long painstaking process of re-accumulating the evidence . |
| 10 | Right from the beginning , we argued that the revolutionary process in El Salvador could only be carried out through a popular war in which the incorporation of the civil population is essential When we take over a village or settlement and the enemy forces are ousted … we begin the work of consciousness raising about the situation of the country together with the work of organizing the local population . |
| 11 | In the previous section we argued that the cereal-packet image of family life in modern Britain was seriously misleading in that , at any one time , relatively few families conform to the image and many households never do . |
| 12 | We argued that the critical requirements in an INSET programme are that the very diverse needs of different teachers be recognized and addressed , that teachers themselves be central to the process of defining their needs , and that diverse needs be met by diverse provision , in respect of not just content and level but also style and venue . |
| 13 | We realized that the unfortunate Wopsle had no understanding of the law , or indeed anything at all . |
| 14 | In a previous paper we reported that the repeating sequence 5'AGGGCCCTAGAGGGGCCCTAG3' displays an anomalous gel mobility , characteristic for curved DNA , even in the absence of AnTm tracts ( 4 ) . |
| 15 | We mentioned that the fixed length line was commonly ‘ C ’ . |
| 16 | When we assembled for Cabinet on 8 October we found that the Prime Minister had suffered a severe attack of his prostate gland trouble during the night and had to see his doctor again . |
| 17 | At the level of grammar we found that the Creole say can replace that within what is otherwise " ordinary " British English , yet at the same time British English past tense markers may appear on " Creole " verbs . |
| 18 | The absence of lamellipodia tallies with another observation : when we grafted a small patch of embryonic skin onto a denuded region of the limb bud surface , we found that the grafted epidermis , far from expanding over the adjacent vacant territory , actually retracted , leaving its own mesenchyme exposed . |
| 19 | We found that the electrical conductivity of our electrolyte-saturated carbon-bearing granulite samples ( A1 , A2 ) decreased with the application of confining pressures as expected . |
| 20 | We found that the electrical conductivity of the electrolyte-saturated carbon-bearing samples increased more steeply with temperature than that for the electrolyte-saturated carbon-free samples ( Fig. 2 ) . |
| 21 | After adjustment for these sexual risk factors we found that the dose-response relation between the number of cigarettes smoked a day and the presence of oncogenic human papillomavirus was still significant ( χ 2 =10.90 , df=1 , p<0.001 ) . |
| 22 | in ulcerative colitis , we found that the cellular proportions of IgG1 and IgG2 in healthy twins were somewhere between controls and affected twins ; but when comparing healthy and affected twins , no statistically significant differences appeared . |
| 23 | In fact we found that the entire surface area was well stocked with fish . |
| 24 | But when we looked at the SVQ in more detail , we found that the underpinning skills and knowledge required would need some extra attention . |
| 25 | For instance , we found that the underpinning knowledge required for the ‘ value base unit ’ in the SVQ can be provided my the following modules : . |
| 26 | Quite apart from the fact that the hardware was working within one hour of delivery we found that the basic functions of each of the packages had been picked up in less than a day . |
| 27 | You can use the whole thing with a mouse ( is there anything you ca n't use a mouse with these days ? ) , but we found that the I-beam cursor was anything but stable with a mouse . |
| 28 | Because we found that the fun factor in pulling the crackers bore no relation to their cost . |
| 29 | In our own tests we found that the Grizzled Skipper with 512K RAM fitted showed little speed advantage over a Super VGA card with 1MB RAM which is commonly fitted in many high-end machines . |
| 30 | We found that the large range of professionals involved in provision and services for young children with special educational needs were often con-fused about how such needs could be predicted and what assessment procedures should be used . |