Example sentences of "we [verb] that [art] [adj] [noun] " in BNC.
Next pageNo | Sentence |
---|---|
1 | We regret that no personal correspondence can be entered into without a stamped-addressed envelope . |
2 | Nevertheless the subject was not forgotten , and we agreed that the average funeral was a complete waste of money which , instead of mourning the dead , should be spent on celebrating their lives . |
3 | We agreed that the prime minister had now definitely lost the coming election . |
4 | so we agreed that the next time a priest was around |
5 | After talks with BR 's Chairman , Peter Parker , we agreed that the sensible way forward was for a new company , British Rail Investments , to be formed and for the subsidiaries to be transferred to the private sector , with the proceeds going to British Rail . |
6 | When we submitted our first Report on the primary stages we recommended that the three profile components , speaking and listening , reading and writing , should be weighted equally in the assessment process . |
7 | When we first cloned the human globin genes we realised that every cloned gene is person-specific , and therefore contains the particular sequences that instruct most of the features which we inherit and that determine our individuality . |
8 | How little we realised that the front line was a focus , that it was important to the Lebanese , the only way to define the undefinable , the only method by which those who had suffered — which meant every Lebanese — could uniquely understand the nature of the calamity that had come upon them . |
9 | After snarling a few choice remarks at them from the corners of our mouths , such as , ‘ Get lost ! ’ or ‘ Beat it ! ’ , which we understood to be good American for , ‘ Please go away , we do not wish for company , ’ we managed to rid ourselves of a few of them , but two of the most persistent followed us until we were clear of the town , and then we realised that the only way to be left alone was for us to be really rude . |
10 | ‘ We realised that the whole psychology of collecting is a fascinating area and that it had a lot more potential … hence the reason for the Festival . |
11 | That is when we realised that the materialistic gap between the rich and poor was indeed nothing compared to the wide gulf in understanding , and that the understanding of health problems in this country would take a long painstaking process of re-accumulating the evidence . |
12 | In Chapter 9 we argued that a private monopolist would make higher profits if it were possible to price-discriminate , charging different prices to customers whose demand curves were effectively distinct . |
13 | Right from the beginning , we argued that the revolutionary process in El Salvador could only be carried out through a popular war in which the incorporation of the civil population is essential When we take over a village or settlement and the enemy forces are ousted … we begin the work of consciousness raising about the situation of the country together with the work of organizing the local population . |
14 | In the previous section we argued that the cereal-packet image of family life in modern Britain was seriously misleading in that , at any one time , relatively few families conform to the image and many households never do . |
15 | We argued that the critical requirements in an INSET programme are that the very diverse needs of different teachers be recognized and addressed , that teachers themselves be central to the process of defining their needs , and that diverse needs be met by diverse provision , in respect of not just content and level but also style and venue . |
16 | We do this because we fear that the other language may not contain the sophisticated concepts we may need in the communication . |
17 | ‘ We fear that the major call-up … could , instead of helping to prevent violence , lead to serious intimidation of local communities and even more violence , ’ the ANC said . |
18 | We postulate that the supradiaphragmatic segment of transposed colon has evolved a MAC type activity in an attempt to overcome the ‘ obstructive ’ effect of the diaphragmatic hiatus . |
19 | With this philosophy in mind , we postulate that the divergent process is the worst possible . |
20 | Yes , if by this we mean that a third party could urge this on the dog 's behalf and that sanctions of the law might well ensue . |
21 | His argument would be that most electronic circuits are organized interactively , by which we mean that the proper operation of one component depends on the normal operation of all of the others . |
22 | We realized that the unfortunate Wopsle had no understanding of the law , or indeed anything at all . |
23 | In a previous paper we reported that the repeating sequence 5'AGGGCCCTAGAGGGGCCCTAG3' displays an anomalous gel mobility , characteristic for curved DNA , even in the absence of AnTm tracts ( 4 ) . |
24 | In view of its clear advantages over the other lasers , whose rate of energy delivery does not match the predicted physical behaviour of the blood vessels , we suggest that the pulsed dye laser should be offered as the first line treatment for portwine stains whenever possible . |
25 | To the extent to which it makes sense to speak of interactions between whole nations at all , we suggest that the two superpowers and their allies may indeed be playing something like the paranoids ' hypergame . |
26 | We suggest that the mere passage of RTW laws will not eradicate unions that are already established : they will continue to extract a rent associated with the wage differential . |
27 | We suggest that the minimum target audience would be teachers in the same neighbourhood in schools with exactly the same computer system and available software utilities . |
28 | We suggest that the high-velocity maser emission in NGC4258 might be from masers orbiting a massive central black hole , or ejected in a bipolar outflow . |
29 | We suggest that the favourable results in respect of severe diabetic acute complications can be explained by the careful counselling of patients before the implementation of intensified insulin therapy and by the quality of glucose self-monitoring . |
30 | Once again we suggest that the deictic centre is located within the context of utterance by the speaker , but that the interpretation of the expression now as relating duratively or subsequently to the utterance , and the time-span involved , must be determined with respect to the content of the utterance . |