Example sentences of "and not in the [noun] [noun sg] " in BNC.
Next pageNo | Sentence |
---|---|
1 | We disagree strongly with any calculation of dosage being based on plasma half life derived from the difference between only two observations , especially if the first of them is taken early in the distribution and not in the elimination phase . |
2 | During the storage in the gall bladder , biliary metastability becomes further reduced only in the cholesterol gall stone patients and not in the gall stone free patients . |
3 | However , the evidence that has finally convinced me that the neutral theory , if not the whole truth , is at least close to the truth concerns changes in the base sequence of DNA , and not in the amino acid sequence of proteins . |
4 | Catches used for tipping rear seats housed in the boot and not in the passenger compartment |
5 | Considering the published data of AG/CT , TA , GG/CC and GC wedge-roll values ( 1,6 ) , the preferential curvature of PyPu ( TA ) , compared to PuPy ( GC ) steps ( 12 ) and crystallographic data ( 10,11 ) , we expected that the region with the major groove-directed curvature is located in the CTAGAG , and not in the GGGCCC part of the curved ( AGGGCCCTAGAGGGGCCCTAG ) n DNA ( 4 ) . |
6 | One of the ways she helps the endangered ecosystem is by always throwing her left-over food on the land , and not in the rubbish bin because its nutrients are valuable as organic fertilizer . |