Example sentences of "and not [prep] the [noun] [noun sg] " in BNC.
Next page| No | Sentence |
|---|---|
| 1 | Their ports and forts in the Spice Islands or the West Indies or the West Coast of Africa were intended as supply bases for shipping and not as the starting point for territorial expansion . |
| 2 | Rebate is only granted on the Council Tax itself and not on the Council water charge which is a separate liability . |
| 3 | In accrediting prior learning , the focus is on the outcomes or achievements of learning and not on the learning process itself . |
| 4 | And it 's it 's on the economic front that regeneration has the highest priority in Leeds and not on the housing front , as I as I 've previously described . |
| 5 | Quite clearly it was for me to initiate action to ensure that all aircraft of that type were checked for similar fractures at the earliest possible moment , but the responsibility for ordering such an inspection lies with the airworthiness authorities of the States in which the aircraft were registered and not with the accident investigation authorities . |
| 6 | This extra bonus applies only to the war boar and not to the Orc rider . |
| 7 | Always remove rose prunings , leaves , blooms and other bits to the fire and not to the compost heap . |
| 8 | That particular single matter was not pursued by the ombudsman an and that therefore means that erm it is n't something that er he felt was a question of maladministration but I did want just to emphasise that this particular point , because in the more er i in the recent report to the Policy Resources Committee on ombudsman complaints , the number , and I ca n't recall exactly what the number was , but the number included in that report relating to planning matters was certainly higher than one , I think there were about half a dozen and what I wanted to take the opportunity of explaining was the , the majority of those all but the one that I 've now referred to , er where in fact relating to district matter planning applications and not to the County Council . |
| 9 | On 3 September a letter was received from William Moorcroft offering his temporary services , it was not followed up , on the ostensible grounds that it was a private letter addressed to Sheldon and not to the College committee in general . |
| 10 | Notice now that the range is compatible only at the virtual computer level and not at the hardware level . |
| 11 | Many schools preferred at that time to have two paymasters rather than one , but in 1926 they were obliged to choose : those which thereafter received grants from the Board of Education in London , and not through the Local Education Authority , were reasonably enough known as direct-grant schools . |
| 12 | In his last public statement as Home Secretary , he announced : ‘ Once again the terrorists have tried to make their point through violence and not through the ballot box . ’ |
| 13 | We disagree strongly with any calculation of dosage being based on plasma half life derived from the difference between only two observations , especially if the first of them is taken early in the distribution and not in the elimination phase . |
| 14 | During the storage in the gall bladder , biliary metastability becomes further reduced only in the cholesterol gall stone patients and not in the gall stone free patients . |
| 15 | However , the evidence that has finally convinced me that the neutral theory , if not the whole truth , is at least close to the truth concerns changes in the base sequence of DNA , and not in the amino acid sequence of proteins . |
| 16 | Catches used for tipping rear seats housed in the boot and not in the passenger compartment |
| 17 | Considering the published data of AG/CT , TA , GG/CC and GC wedge-roll values ( 1,6 ) , the preferential curvature of PyPu ( TA ) , compared to PuPy ( GC ) steps ( 12 ) and crystallographic data ( 10,11 ) , we expected that the region with the major groove-directed curvature is located in the CTAGAG , and not in the GGGCCC part of the curved ( AGGGCCCTAGAGGGGCCCTAG ) n DNA ( 4 ) . |
| 18 | One of the ways she helps the endangered ecosystem is by always throwing her left-over food on the land , and not in the rubbish bin because its nutrients are valuable as organic fertilizer . |
| 19 | Spits differ chiefly from offshore bars in that they spring from the coast and are supplied with material mainly by longshore drift and not from the sea floor . |
| 20 | Yet , if that were so , why did his plan entail an attack from the east bank of the Meuse only , and not from the west bank also , to achieve a successful pincer operation ? |
| 21 | Notice that the design which has been used for weaving does not show as with the sample woven with the smooth yarn , always select simple designs for weaving because the pattern in the fabric results almost entirely from the yarn and not from the needle selection . |
| 22 | If any of the matters in issue have to be decided again , this must be done by the original deciding authority and not by the supervising court . |
| 23 | The recommendations of the panel are expected to be heeded by Congress , since it was selected by several congressional committees and not by the timber industry or environmentalists . |