Example sentences of "be [verb] [prep] a [noun sg] [adv] " in BNC.
Next page| No | Sentence |
|---|---|
| 1 | But , while her non-dramatic soul was saying that to present herself at Vasey 's looking the way she did was going a bit over the top , she had never been dismissed from a job before . |
| 2 | The Police Complaints Authority may direct that disciplinary charges are heard by a tribunal rather than by a chief officer sitting alone . |
| 3 | For trousers , socks and shoes , the garments are placed on a stool slightly to the side of the patient . |
| 4 | ‘ L'Etat c'est moi ’ was a shrewd remark , but can hardly have been intended as a definition even in the France of the time . |
| 5 | The account hovers on the brink of farce , and must surely have been intended as a spine-chiller more analogous to a modern horror film than a literal description of something which was to be believed in . |
| 6 | The place had been intended as a family home , he had told her . |
| 7 | His splendidly preserved antique desk had been placed like a barrier solidly across the room about two thirds of the way up . |
| 8 | It is a rare but recognised phenomenon that headaches as a result of sexual intercourse might indicate his condition which could have been treated by an operation regularly performed by neurosurgeons . ’ |
| 9 | These have been calculated by a technique misleadingly known as ‘ programme budgeting ’ . |
| 10 | Herodotus has long been regarded as a mythographer as much as a historian , for he records not just the bare facts , but the multiple versions of events he has gathered from a variety of sources . |
| 11 | Anthony Caro 's ‘ Tower of Discovery ’ has already been erected in a plaza close to the entrance to Expo 's site . |
| 12 | Whereas this job , although it centres around the similar sort of thing , has become much more diverse particularly in the last three or four years with our involvement with deposit of poisonous waste and site licensing … ; planning applications are referred to a lot more now than when I first started . |
| 13 | In reality heavy drinking is far more pervasive than is commonly realized and most drugs which are consumed to excess are prescribed by a GP rather than bought illegally . |
| 14 | Dick 's fighter was not without its problems , the primary one being that the fuselage had been modified with a hacksaw so that there would be room to put a second seat in the airframe . |
| 15 | Once we are entrapped in a dilemma then action of one sort or another is predetermined . |
| 16 | The jury had been confined to an hotel overnight and , in the judgment of Lord Lane , C.J. , any risk of prejudice was capable of being overcome by denying it access to radio and television . |
| 17 | Miss Goody Two Shoes has n't been to work for a week apparently . |
| 18 | A dozen shags and a cormorant are perched on a stack nearby and , as usual , the cormorant is the first to ‘ chicken out ’ and fly off as we approach . |
| 19 | Both the arms of the saltire and the semi-roundels are decorated in a manner quite different to similar panels in the Middleborough mosaic . |
| 20 | Closed Circuit Television cameras are appearing at a location near you — or , at least at the east end of Princes Street , Tollcross , Haymarket , St. John 's Road , Leith Walk and Quality Street . |
| 21 | The sand grains themselves are confined to a layer very near to the surface and thus their erosive effect is very limited in vertical extent , while surface creep can obviously affect only an extremely limited vertical range . |
| 22 | ‘ Every room here has been booked since a year ago , and I was dearly hoping Donna would screw up the nerve to send her packing , but Mrs Foster happened by , and Matthew 's fiancée recognised her . |
| 23 | These amines are metabolized by an enzyme now named monoamine oxidase . |
| 24 | In this type of support system the front line units are considered as a layer just like all the other layers . |
| 25 | In particular , he fails to comment on the fact that eighty-five per cent of the seven-year-olds passed item ( 1 ) — a fact which suggests that even younger children might have been capable of passing this item , especially if it had been presented in an oral rather than a written form . |
| 26 | What a lot of stupid people they are to listen to a preacher anyway ! |
| 27 | Scats may be accumulated outside den entrances ( Poole , 1970 ) , and a very large assemblage of polecat scats has been collected from an area less than two metres square outside a den in Rhosgogh Bog in mid-Wales . |
| 28 | The effect of the GC step in the context of GGGCCC motif seems to be about as large as that of AA/TT , i.e. it is apparently enough to cancel the macroscopic curvature of helically phased A-tracts.The origin of the macroscopic curvature for the ( AGGGCCCTAGAGGGGCCCTAG ) n DNA can be explained by an overall roll angle difference between the GGGCCC and CTAGAG sequence elements , which will add up if the two motifs are separated by a distance close to the helical repeat length . |
| 29 | Consequently , many people who are ageing with a disability simply fall through the net . |
| 30 | It has been operating for a year now , with the aim of showing researchers both the benefits of massively parallel computers and how to use them . |