Example sentences of "be [verb] [verb] a [num] [noun] " in BNC.
Next page| No | Sentence |
|---|---|
| 1 | Details were sketchy as NME went to press , but it is understood that an application to Northaven District Council in the west country has been made to host a 100,000 capacity open air event , running over June 21 , 22 and 23 — the weekend Glastonbury traditionally takes place . |
| 2 | Well I think that when yo , we 're going to get a hundred percent nomination there . |
| 3 | you 're going to get a million pounds . |
| 4 | This morning it went to number one this is tremendous news and from it we 're going to have A Hundred Children . |
| 5 | They have been shown to express a 72 kDa type IV collagenase/gelatinase with activity against the normal liver matrix , tissue inhibitor of metalloproteinase-1 ( TIMP-1 ) , a potent inhibitor of the matrix degrading metalloproteinases and they also express interstitial collagenase , an enzyme with degradative activity against the excess interstitial collagens that characterise fibrosis . |
| 6 | To simply say to the public we are going to spend a million pound on traffic calming is downright irresponsible and this . |
| 7 | Colm Holmes was highly commended for his presentation of the quiz and he has been invited to chair a six week Christmas quiz at this venue in November/December . |
| 8 | A manufacturing company would be expected to maintain a 1:1 ratio to be credit worthy . |
| 9 | Such procedures are right for generating the phenomenon in Wagner 's associative form — a series of widely spaced exposure trials will promote the formation of a context-stimulus association ; and the after-effects of presentation of the target stimulus could not be expected to survive a 24-h retention interval . |
| 10 | Unfortunately , this needs 2 command lines and must be done using a CLI command file . |
| 11 | And we accept that there is no magic wand which can be waved to provide a million jobs overnight . |
| 12 | The amount of processing power likely to be required indicated a sixteen bit processor . |
| 13 | Inside it had been converted to make a dozen study bedrooms with shared facilities and a self contained warden 's flat , painted a bland cream throughout and carpeted with the tough fibre matting that was a feature of all the student halls and houses . |
| 14 | The Wolverton design team continued to develop this successful system , and in 1938–39 were experimenting to develop a 30 cwt — 2 ton unit . |
| 15 | Primers were designed to amplify a 305 base pair product as INS 1 : 5' CGTGAGGGCATCGAGGTGGC 3' and INS 2 : 5' GCGTAGGCGTCGGTGACAAA 3' . |
| 16 | From the 5' region of IS902 , primers P102 ( 5'-CTGATTGAGATCTGACGC-3' ) and P103 ( 5'-TTAGCAATCCGGCCGCCCT-3' ) were selected to amplify a 252 bp fragment ( nucleotides 132–383 ) , unique to IS902 . |
| 17 | These findings are consistent with our early experience , when attempts were made to isolate a 10 cm segment of oesophagus between two occluding balloons in six subjects . |
| 18 | First , the 1981 Census of Population was not made available for grid squares and , second , our estimates were produced using a 1984 satellite image and 1981 Census ward data . |
| 19 | After washing in tap water and then Tris buffer ( pH 7.3 ) for 5 minutes ( ×3 ) , sections were stained using a three stage peroxidase procedure in which Ki-67 monoclonal antibody ( 1:50 in Tris buffer ) , biotinylated rabbit anti-mouse ( 1:300 in Tris buffer ) , and avidin-biotin complex ( Dakopatts ) were applied . |
| 20 | Survey recipients were asked to complete a three page questionnaire . |
| 21 | Disabled rail travellers are being forced to make an eighty mile detour to get to their nearest city thirteen miles away . |
| 22 | Wheelchair travellers used to cross the track on boards laid down for mail trolleys.But now the disabled are being forced to make an eighty mile detour via Shrewsbury to get to Hereford because British Rail have taken up the boards for safety reasons.We joined the Leominster Disabled Access group on a trip to Hereford . |
| 23 | Differences in duodenal prostaglandin release were determined using a two way analysis of variance for multiple comparisons , and the Student 's t test for single comparisons . |
| 24 | The teachers who were selected to teach the smoking and me project were required to attend a one day training seminar which familiarised them with the project guide and the group leader approach to teaching . |
| 25 | In the Edinburgh derby , Hibs are trying to break an eighteen match run without a victory , stretching back to January nineteen eighty-nine . |
| 26 | I am hoping to buy a 4–5 year old Ninety diesel . |
| 27 | WaveLAN uses low power — 100mW — 2.4GHz spread spectrum technology and is claimed to have a 600 foot operating radius in open plan offices , with a 2Mbps data throughput . |
| 28 | Based on the Teesside Development Corporation 's ‘ renaissance ’ project along the river banks and old docklands , the museum is expected to attract a million visitors a year from its opening in 1995 . |
| 29 | FORMER Notts pace bowler Kevin Cooper is expected to sign a one year contract with Gloucestershire . |
| 30 | BSDI , an alleged spin-off of UC Berkeley 's Computer Sciences Research Group , author of the famous Berkeley code , is attempting to commercialise a 386 operating system called BSD/386 based on the university 's Network Release 2 . |