Example sentences of "enough [to-vb] the [adj] " in BNC.
Next pageNo | Sentence |
---|---|
1 | Mental disturbance requiring such security is often short-lived and within a week or two the person may be well enough to enjoy the normal freedoms accorded other patients . |
2 | Michael made a good recovery , and was well enough to enjoy the international conference given at the time of his retirement . |
3 | ‘ We were lucky enough to enjoy the fine weather and gentle hills while raising money for a good cause , ’ he added . |
4 | For most people it seems that it is necessary to stay long enough to enjoy the bad weather as well as the good , to gain a true appreciation of the countryside . |
5 | All you have to do is to understand the right habit or growing style of the crops and time your sowings and plantings with that in mind , ensuring that soil fertility levels are kept high enough to support the extra output . |
6 | Benjamin had just lived long enough to see the first of his children married : Ella Frances May Titford 's wedding had taken place on 26 August 1905 , in that very church in which her father was to collapse eight days later . |
7 | He had stayed long enough to see the first stage of the counter-inflation policy accepted and the clash and confrontation of two years earlier replaced by a new partnership . |
8 | If you watch carefully you may also be lucky enough to see the male and female adults mating or to see the females laying their eggs . |
9 | Those of us lucky enough to see the wonderful 1960 European Cup Final between Real Madrid and Eintracht Frankfurt can truthfully say that it changed our attitude to football . |
10 | The park is teeming with big game and you may be lucky enough to see the Royal Bengal Tiger . |
11 | By now he was close enough to see the red blotches erupting on her creamy skin . |
12 | It was one of those gorgeous early mornings when the sun has just risen but it 's still dark enough to see the brightest stars . |
13 | He welcomed the European Commission on Human Rights ' ruling that the case of the three IRA members killed by the SAS in Gibraltar was good enough to go the European Court . |
14 | ‘ It was Mrs Hardcastle — Alison has a nasty attack of flu , and she wo n't be fit enough to wear the chief bridesmaid 's dress on Saturday . ’ |
15 | Those ladies slim and brave enough to wear the high fashion were ethereal in gauzy dresses that clung to their bodies as they moved . |
16 | So the second factor that the Prime Minister overlooked is that the existing chamber in Strasbourg is simply not large enough to accommodate the extra numbers of Euro MPs who will be elected to the European parliament , not so much as a result of the Edinburgh agreement , but in fact as a result of the er enlargement that is in prospect . |
17 | The body is solid alder , arched gently at the front and back and tapering to a width which is just wide enough to accommodate the Switchcraft-type output jack socket on the lower rim . |
18 | On the other hand it must be subtle and flexible enough to accommodate the diverse forms of capitalist society , and to be immune to refutation by counter example . |
19 | On Nov. 13 and 17 respectively the court ruled that Stoph , who had not been well enough to attend the previous day and had heart problems , and Mielke were too ill stand trial . |
20 | The first stages are fitted with input offset adjustments just large enough to cancel the largest field likely to be encountered , namely the total inclined component in the middle latitudes . |
21 | The effect of the GC step in the context of GGGCCC motif seems to be about as large as that of AA/TT , i.e. it is apparently enough to cancel the macroscopic curvature of helically phased A-tracts.The origin of the macroscopic curvature for the ( AGGGCCCTAGAGGGGCCCTAG ) n DNA can be explained by an overall roll angle difference between the GGGCCC and CTAGAG sequence elements , which will add up if the two motifs are separated by a distance close to the helical repeat length . |
22 | It certainly continues beyond 10 bars but this is deep enough to include the main cloud layers that are likely to exist . |
23 | Hilts has fallen under the spell of each in turn — not so deeply as to distort fact , but deeply enough to lose the sardonic , sceptical qualities that ought never quite to desert the journalist . |
24 | Solowka is refreshingly honest , but the band 's efforts were legitimate enough to prompt the British Ukrainian Association to ask them to appear in a video newsletter and the set definitely broadened the band 's appeal . |
25 | The cuts do not have to be deep , just enough to enable the two lapel corners to be lifted with the thin wedge end of the knife handle to reveal the green cambium layer beneath . |
26 | The quality is good enough to enable the 158s to replace the Mark 3 push-pull trains in Scotland as well as the Mark 2s . |
27 | A vivid light flared outside , bright enough to penetrate the heavy curtains . |
28 | According to Campaigns Director Andrew Lees , : " Given the potentially broad scope of such " areas " , the obstructive official has ample opportunity to rebuff requests by anyone whose request is not specific enough to penetrate the bureaucratic defences of a body which does not want to release the information . " |
29 | As the existing windows were more than large enough to light the second-storey accommodation to building regulations standards , it was decided to shorten these openings . |
30 | While Kāli fumbled , striking the flint against the steel , trying to produce a spark that was strong enough to light the little piece of cotton , they told me how pleased they were to see me working just like them . |