Example sentences of "do [prep] [num] " in BNC.
Next page| No | Sentence |
|---|---|
| 1 | She would just have to cling to her professional integrity as she had done for fifty years , and she would , as she had always tried to , make that sufficient . |
| 2 | Well considering nothing 's been done for fifty year I suppose really |
| 3 | What you 've done for six long years , and more especially what you 've been doing to me ever since we met again ? ’ |
| 4 | THE LABOUR leader , Mr Neil Kinnock , challenged the Prime Minister yesterday to allow the pay of 22,000 ambulance staff to be referred to a pay review body , as is done for 600,000 health service workers . |
| 5 | As an acquaintance put it , ‘ Richard would apply only if the university did something it has n't done for 500 hundred years — say it 's sorry . ’ |
| 6 | While the domination of the criminal market was well known within the profession nothing was done for two main reasons : first , solicitors were making a handsome living and were under no pressure to find or create alternative sources of income : and second , there appeared to be no way in which these cartels could be broken by ethical means : |
| 7 | Generally speaking , rechunking is done for two main reasons : ( a ) the source text is divided into chunks ( whether sections , paragraphs , sentences , or clauses ) that are either too long or too short in terms of target-language average chunking of similar material ; or ( b ) the nature of the target audience is different in terms of level of specialization , age , etc . |
| 8 | If this could be done for one product , it could be done for others with their own market strategies and situations . |
| 9 | Some say that The Mercy Seat is the best thing Cave has done for five years , since Mutiny in Heaven . |
| 10 | And that 's what causes tragic failures like Matthew Smith and Augustus John — they 've done the Paris rat and they live ever after in the shadow of Gauguin and Matisse or whoever it may be — just as G.P. says he once lived under the shadow of Braque and suddenly woke up one morning to realize that all he had done for five years was a lie , because it was based on Braque 's eyes and sensibilities and not his own . |
| 11 | If you had stood as I have done for five hours in a draughty ante-room of a courthouse sticking sixpences into one of those things to see how frequently it paid out , you would n't be so keen to chuck your money away , son . |
| 12 | a hundred and ninety five pound , if I could get mine done for five hundred I 'd be laughing ! |
| 13 | You can get it done for five pence there . |
| 14 | He was done for four years for fraud . |
| 15 | Working-class women cuddled their babies up in the warm as women had done for millions of years . |
| 16 | Because of the division of labour , work soon became the perpetual repetition of a simple task , or the minding of a machine ; such work often had to be done for fourteen hours a day , six days a week , and there were no special provisions for the women and very young children who were considered especially suitable for work in the textile industries . |
| 17 | When Elizabeth I came to the throne of England in 1558 she and her government in London ruled less land than her predecessors had done for hundreds of years . |
| 18 | ‘ It seems that the establishment thinking is that if it 's been done for 175 years , it must be all right . |
| 19 | IF some of the jurors had suffered from rheumatoid arthritis , as I have done for 33 years , the verdict would have been emphatically in favour of Dr Cox . |
| 20 | The hot water pipes gurgled as they had done for ten years . |
| 21 | Obviously I get the odd pains from it because I 'm doing things I have n't done for 15 months . |
| 22 | The new non-socialist party looks more agreeable than it has done for 20 years . |
| 23 | The assay was done for 30 min in the presence of either 0.1μM free Ca 2+ and 0.9mM sodium deoxycholate ( + ) , or 10μM free Ca 2+ and 3.4mM sodium deoxycholate ( ++ ) . |
| 24 | The house looked as it had done for three centuries ; Lord Cumbermound was in no doubt that it would manage another three . |
| 25 | This was done for three different exposures . |
| 26 | Briefly , the reverse strand primer TTCCTTCATCTAAATCATCT ( 0.5pmol ) was labelled with 35 S ATP and the supplied TTP cycle mix and reaction buffer for 80PCR cycles with annealing at 55°C for 45s , and subsequent termination reactions done for 50 cycles with annealing at 60°C for 45s . |
| 27 | It 's doing what they 've always done for 50 years . |
| 28 | And it 's already in your calculator now , so you can just do times three sixty . |
| 29 | Jules Olitski 's brush-stroke abstractions iridesce at Salander O'Reilly ( 6 April-6 May ) and Robert Miller has mounted a show of Joan Mitchell 's paintings done during 1992 , the last year of her life ( until 1 May ) . |
| 30 | This would be done during 1990 . |