Example sentences of "[is] [adv] enough [to-vb] " in BNC.
Next page| No | Sentence |
|---|---|
| 1 | One bad year is rarely enough to produce famine . |
| 2 | These are waters which do not , as a rule , produce big bream , for with so many mouths to share the available food there is only enough to maintain them at a low body weight . |
| 3 | Epictetus replied , ‘ To all this it is perhaps enough to answer , I do not need them . ’ |
| 4 | The effect of the GC step in the context of GGGCCC motif seems to be about as large as that of AA/TT , i.e. it is apparently enough to cancel the macroscopic curvature of helically phased A-tracts.The origin of the macroscopic curvature for the ( AGGGCCCTAGAGGGGCCCTAG ) n DNA can be explained by an overall roll angle difference between the GGGCCC and CTAGAG sequence elements , which will add up if the two motifs are separated by a distance close to the helical repeat length . |
| 5 | Metabolic activity arising from muscular exercise , coupled with insulation in the form of layered windproof clothing , is generally enough to maintain human body temperature against polar extremes . |
| 6 | And it is not enough to devote four pages to ‘ sexual orientation ’ and then lamely say it deserves more attention . |
| 7 | It is not enough to visit or telephone the offices of the local authority , water authority and public utilities , to verify the availability of services . |
| 8 | But of course it is not enough to point out that such claims can be made implicitly . |
| 9 | The energy left over , about 30 GeV , is not enough to create W particles , if electroweak theory is correct . |
| 10 | The fact that manufacturer B produced a safer razor after the razor in question had been supplied by manufacturer A is not enough to enable us to say that manufacturer A's razor was defective . |
| 11 | President Reagan lifted the ban two years ago , but the Barnwell consortium says this is not enough to expunge the injury caused by Carter to its plans . |
| 12 | There is still a feeling , and rightly so , that every firm owes some responsibility to its members and their dependants in this respect and that it is not enough to leave it to the individual partner to make his own arrangements . |
| 13 | It is not enough to acknowledge the importance of collective entrepreneurship ; clear and consistent signals must reinforce the new story . |
| 14 | But it is not enough to talk about ‘ jobs ’ as if , provided enough people have jobs , all is well . |
| 15 | It is not enough to talk generally about reverence and respect any longer . |
| 16 | For example , it is not enough to talk simply in terms of the 103 ; the 103.2 , which formed part of a British system that we recommended in August 1985 was a completely different design from the present 103/4 . |
| 17 | That is the most fallacious part of the argument : drawing a distinction between French and German anti-Semitism is not enough to exonerate Vichy of an anti-Semitic policy . |
| 18 | To see objects , it is not enough to see surfaces , although that is an excellent start . |
| 19 | Natural daylight is not enough to allow for this process . |
| 20 | Although the degree of compression is not enough to allow retrieval from a compact disc , using a fast magnetic hard disc , reasonable full screen full motion video can be achieved . |
| 21 | But it is not enough to do a good job : our professional conduct committees must be seen to be doing a good job . |
| 22 | Cnut may well have profited from this sort of process , for the sources are scanty and their silence on the matter of simony is not enough to rule it out . |
| 23 | It is not enough to rely on vitamin pills and hope for the best . |
| 24 | And 99 per cent of women have jobs , even if they have children , because one salary is not enough to support the family . |
| 25 | Before I came to prison I thought I was introspective but ten minutes here and there is not enough to answer some of these questions |
| 26 | It is not enough to agree a deal in principle with a receiver , the purchaser will have to deliver the cash before anyone else in order to win . |
| 27 | But this is not enough to deal with the multiple expressions and experiences of subjectivity . |
| 28 | A chapter is not enough to describe this fine mountain . |
| 29 | But utilitarianism is not enough to sustain woman-centred feminism 's more dramatic ambitions . |
| 30 | It is not enough to give folk dances theatrical form by opening out their patterns , paying increased attention to the relationship of step to music and developing any unique style of movement . |