Example sentences of "[be] [verb] [prep] a [noun sg] [adv] " in BNC.

  Next page
No Sentence
1 But , while her non-dramatic soul was saying that to present herself at Vasey 's looking the way she did was going a bit over the top , she had never been dismissed from a job before .
2 The Police Complaints Authority may direct that disciplinary charges are heard by a tribunal rather than by a chief officer sitting alone .
3 For trousers , socks and shoes , the garments are placed on a stool slightly to the side of the patient .
4 ‘ L'Etat c'est moi ’ was a shrewd remark , but can hardly have been intended as a definition even in the France of the time .
5 The account hovers on the brink of farce , and must surely have been intended as a spine-chiller more analogous to a modern horror film than a literal description of something which was to be believed in .
6 The place had been intended as a family home , he had told her .
7 His splendidly preserved antique desk had been placed like a barrier solidly across the room about two thirds of the way up .
8 These have been calculated by a technique misleadingly known as ‘ programme budgeting ’ .
9 Herodotus has long been regarded as a mythographer as much as a historian , for he records not just the bare facts , but the multiple versions of events he has gathered from a variety of sources .
10 Anthony Caro 's ‘ Tower of Discovery ’ has already been erected in a plaza close to the entrance to Expo 's site .
11 Whereas this job , although it centres around the similar sort of thing , has become much more diverse particularly in the last three or four years with our involvement with deposit of poisonous waste and site licensing … ; planning applications are referred to a lot more now than when I first started .
12 In reality heavy drinking is far more pervasive than is commonly realized and most drugs which are consumed to excess are prescribed by a GP rather than bought illegally .
13 Dick 's fighter was not without its problems , the primary one being that the fuselage had been modified with a hacksaw so that there would be room to put a second seat in the airframe .
14 Once we are entrapped in a dilemma then action of one sort or another is predetermined .
15 Miss Goody Two Shoes has n't been to work for a week apparently .
16 A dozen shags and a cormorant are perched on a stack nearby and , as usual , the cormorant is the first to ‘ chicken out ’ and fly off as we approach .
17 Both the arms of the saltire and the semi-roundels are decorated in a manner quite different to similar panels in the Middleborough mosaic .
18 Closed Circuit Television cameras are appearing at a location near you — or , at least at the east end of Princes Street , Tollcross , Haymarket , St. John 's Road , Leith Walk and Quality Street .
19 The sand grains themselves are confined to a layer very near to the surface and thus their erosive effect is very limited in vertical extent , while surface creep can obviously affect only an extremely limited vertical range .
20 ‘ Every room here has been booked since a year ago , and I was dearly hoping Donna would screw up the nerve to send her packing , but Mrs Foster happened by , and Matthew 's fiancée recognised her .
21 In this type of support system the front line units are considered as a layer just like all the other layers .
22 What a lot of stupid people they are to listen to a preacher anyway !
23 The effect of the GC step in the context of GGGCCC motif seems to be about as large as that of AA/TT , i.e. it is apparently enough to cancel the macroscopic curvature of helically phased A-tracts.The origin of the macroscopic curvature for the ( AGGGCCCTAGAGGGGCCCTAG ) n DNA can be explained by an overall roll angle difference between the GGGCCC and CTAGAG sequence elements , which will add up if the two motifs are separated by a distance close to the helical repeat length .
24 Consequently , many people who are ageing with a disability simply fall through the net .
25 It has been operating for a year now , with the aim of showing researchers both the benefits of massively parallel computers and how to use them .
26 The work itself is a primary source , since the data have not been taken from other published sources — if they are presented in a survey actually supervised by the writer .
27 All of us are living in a diaspora twice removed — that is , our ancestors were already immigrants when we were born , and we , or our families , have repeated it again , going this time to the country of our past colonial masters .
28 PageMaker has a very clever habit of remembering all the changes that have been made to a document so that they can either be Undone or Reverted to .
29 ‘ I have been saving for a while now , ’ Yanto began , ‘ and by tonight I shall have a hundred and fifty .
30 If , for example , I am engaged in reading a text on a subject in which I am well versed ( where the ideational or content schema is familiar ) , which has been written in a manner conventionally associated with writing on this subject ( where the interpersonal or formal schema is familiar ) , then I shall only need to pay attention to the linguistic signs to the extent that they key in this schematic knowledge and indicate how it is to be extended .
  Next page