Example sentences of "[be] [verb] [prep] a [noun sg] [adv] " in BNC.
Next pageNo | Sentence |
---|---|
1 | But , while her non-dramatic soul was saying that to present herself at Vasey 's looking the way she did was going a bit over the top , she had never been dismissed from a job before . |
2 | The Police Complaints Authority may direct that disciplinary charges are heard by a tribunal rather than by a chief officer sitting alone . |
3 | For trousers , socks and shoes , the garments are placed on a stool slightly to the side of the patient . |
4 | ‘ L'Etat c'est moi ’ was a shrewd remark , but can hardly have been intended as a definition even in the France of the time . |
5 | The account hovers on the brink of farce , and must surely have been intended as a spine-chiller more analogous to a modern horror film than a literal description of something which was to be believed in . |
6 | The place had been intended as a family home , he had told her . |
7 | His splendidly preserved antique desk had been placed like a barrier solidly across the room about two thirds of the way up . |
8 | These have been calculated by a technique misleadingly known as ‘ programme budgeting ’ . |
9 | Herodotus has long been regarded as a mythographer as much as a historian , for he records not just the bare facts , but the multiple versions of events he has gathered from a variety of sources . |
10 | Anthony Caro 's ‘ Tower of Discovery ’ has already been erected in a plaza close to the entrance to Expo 's site . |
11 | Whereas this job , although it centres around the similar sort of thing , has become much more diverse particularly in the last three or four years with our involvement with deposit of poisonous waste and site licensing … ; planning applications are referred to a lot more now than when I first started . |
12 | In reality heavy drinking is far more pervasive than is commonly realized and most drugs which are consumed to excess are prescribed by a GP rather than bought illegally . |
13 | Dick 's fighter was not without its problems , the primary one being that the fuselage had been modified with a hacksaw so that there would be room to put a second seat in the airframe . |
14 | Once we are entrapped in a dilemma then action of one sort or another is predetermined . |
15 | Miss Goody Two Shoes has n't been to work for a week apparently . |
16 | A dozen shags and a cormorant are perched on a stack nearby and , as usual , the cormorant is the first to ‘ chicken out ’ and fly off as we approach . |
17 | Both the arms of the saltire and the semi-roundels are decorated in a manner quite different to similar panels in the Middleborough mosaic . |
18 | Closed Circuit Television cameras are appearing at a location near you — or , at least at the east end of Princes Street , Tollcross , Haymarket , St. John 's Road , Leith Walk and Quality Street . |
19 | The sand grains themselves are confined to a layer very near to the surface and thus their erosive effect is very limited in vertical extent , while surface creep can obviously affect only an extremely limited vertical range . |
20 | ‘ Every room here has been booked since a year ago , and I was dearly hoping Donna would screw up the nerve to send her packing , but Mrs Foster happened by , and Matthew 's fiancée recognised her . |
21 | In this type of support system the front line units are considered as a layer just like all the other layers . |
22 | What a lot of stupid people they are to listen to a preacher anyway ! |
23 | The effect of the GC step in the context of GGGCCC motif seems to be about as large as that of AA/TT , i.e. it is apparently enough to cancel the macroscopic curvature of helically phased A-tracts.The origin of the macroscopic curvature for the ( AGGGCCCTAGAGGGGCCCTAG ) n DNA can be explained by an overall roll angle difference between the GGGCCC and CTAGAG sequence elements , which will add up if the two motifs are separated by a distance close to the helical repeat length . |
24 | Consequently , many people who are ageing with a disability simply fall through the net . |
25 | It has been operating for a year now , with the aim of showing researchers both the benefits of massively parallel computers and how to use them . |
26 | The work itself is a primary source , since the data have not been taken from other published sources — if they are presented in a survey actually supervised by the writer . |
27 | All of us are living in a diaspora twice removed — that is , our ancestors were already immigrants when we were born , and we , or our families , have repeated it again , going this time to the country of our past colonial masters . |
28 | PageMaker has a very clever habit of remembering all the changes that have been made to a document so that they can either be Undone or Reverted to . |
29 | ‘ I have been saving for a while now , ’ Yanto began , ‘ and by tonight I shall have a hundred and fifty . |
30 | If , for example , I am engaged in reading a text on a subject in which I am well versed ( where the ideational or content schema is familiar ) , which has been written in a manner conventionally associated with writing on this subject ( where the interpersonal or formal schema is familiar ) , then I shall only need to pay attention to the linguistic signs to the extent that they key in this schematic knowledge and indicate how it is to be extended . |