Example sentences of "[pron] [adj] at the [adj] [noun sg] " in BNC.
Next pageNo | Sentence |
---|---|
1 | If one broadens that range and spreads it more evenly , one gets away from the present situation in which those at the bottom end of the range are paying more than they need to pay because of the way the system has been constructed . |
2 | Recombinants ‘ oligo I ’ and ‘ oligo III ’ were produced by cloning the sequence CTGGGGAGGCGACCCCTCCCCCCTTGTCCCGACT ( nts -527 to -494 ) and its complementary or the oligonucleotide TCGCCCAGCTCAGGGCCGCGTGTGTTAGTT ( nts -479 to -450 ) and its complementary at the HindIII site of plasmid pBLcat2 ( 16 ) . |
3 | The great problem for any navigator was to know where his ship was : it was relatively easy to determine the latitude , which measures distance north or south of the equator , but it was much harder to find the longitude , or distance east or west of a fixed meridian — a line from pole to pole running through all the points at which the sun is at its highest at the same moment . |
4 | Similarly a grant is paid to staff who move from a rented unfurnished house or flat to a similar property at the new base or who buy a house of their own at the new location . |
5 | But she comes into her own at the not-bloody-likely tea party ; and by the end , she has achieved just the right blend of poignancy and pride . |
6 | If a composer remembers to keep this audience entertained , think what he can say to them all at the same time . |
7 | Which is probably better than getting them all at the same time . |
8 | Does this mean therefore that RMI has to be a massive concentrated effort to bring everything on-stream at the same time ? |
9 | Perhaps there 's something worse at the other end of this creepy corridor . |
10 | A good horse trainer teaches a horse good habits so that it does what he wants it to do automatically , without it learning any undesirable behaviour or bad habits in the process ; but a poor trainer often finds that his horses learn something unwanted at the same time . |
11 | Robyn swallowed and glanced out at the pouring rain , glanced at him , at the carved , arrogant profile that irked and thrilled her all at the same time and then at the rain again . |
12 | You ca n't and keep them open at the same time . |
13 | However , Ada had made it clear at the first round of talks that the commission had no power to negotiate changes , which had to be approved by referendum . |
14 | Oddly , it might seem , running the signal through this electronic sausage machine can make it clearer at the far end . |
15 | And then he blew it all at the last minute with that interference . |
16 | Er the perceiving people do n't , it does n't worry them very much , they 'll do it all at the last minute and get it sorted out somehow . |
17 | cos they book it all at the same time |
18 | Charles obliged , and filled up his own at the same time . |
19 | With the preparation unquestionably right , therefore , the question was , ‘ could Forget demonstrate the big heart and the ability to play at his best at the right time ? ’ |
20 | But it is worth bearing in mind that he is a fine iron player and , until his seven at the 10th hole in the third round of the Players ' Championship , he was jointly leading the field . |
21 | He bent down , still trying to keep them both at the same height . |
22 | I often missed Constanza , but not being with them both at the same time was easier . |
23 | Hold them at the same height above the ground and let go of them both at the same moment . |
24 | ‘ You can get us all at the same time this way . ’ |
25 | Amanda said : ‘ I 'm sorry it was them and glad it was n't us all at the same time . ’ |
26 | I hope you can join us all at the same time next Saturday ; United at home to Barnsley in a division two match . |
27 | THE Coleraine club and local competitors again did us proud at the European Championship meeting at Kirkistown . |
28 | And you 're doing your utmost at the other end straining , trying even harder and harder , the harder you try often the worse it gets . |